fatigued

The most recent rephrasing of the term “burnout” is “compassion fatigue”.  At least that’s what they’re calling it among medical professionals.  But I don’t think that’s exactly what I’m feeling.  In fact, I’m certain that it’s not, because I haven’t interacted with very many patients yet.  No, I’m just fatigued.  Compassion has nothing to do with it.

I feel like I could, right now, quit school and be adequately satisfied.  I just finished my second year of medical school and now I’m off to PhD-land to work for the next 4 to 5 years. Before starting in the lab, though, I have the USMLE Step 1 exam.  This is likely one of the most important exams of my life and I should be preparing more than I am, but I feel kind of numb to the urgency.  It’s as if I’ve accepted that a small improvement in my test score isn’t worth the quantity and rigor of the effort required.

I’ve kind of checked out.  And my feelings are even further complicated by my final exam scores that I just received today.  I passed, which is all that matters in the end.  But my score was substantially lower than what I had expected.  This is more of an ego bruise than anything.  I felt like I had done reasonably well.  Getting a low score puts questions into my mind about whether I really know what I’m doing.  (But if you ask any seasoned physician they’d say that no second year really knows what she/he is doing yet.  Somehow that’s not comforting.)  It shook my confidence.  But despite the sting, this is probably good for me.  The last thing this world needs is more overconfident medical students.

Back to PhD-land…

I have a meeting this afternoon with my new mentor.  He’s a strong scientist, an MD/PhD grad, and a nice guy.  But I’m nervous that I have little to discuss with him.  I’ve set up email alerts for papers in certain subjects, but so far that’s as far as I’ve gone.  I haven’t really read any of the papers.  I have ideas, but they’re very broad.  None of them are appropriate thesis ideas.

Since I’m just venting, and this is terribly uninteresting to read, I’ll get to some point…

Bottom line:  I’m stuck in a difficult place right now.  The path of my classmates and friends is diverging from my path.  I’m uncomfortable with mediocrity (even when it’s adequate), but I lack the time, energy, and will to achieve anything more than the minimum required right now.  I guess that’s kind of what burnout is.  My passion for this stuff has faded from a bright flame to a tiny glowing ember.  I really need to find some gas to pour on and start up the fire again.  Tricky part is… if I throw too much on too fast it smothers the ember.  What I need is not too much, not too little, but juuuuuust enough.

That’s another phrase I’ve heard thrown around lately: the “Goldilocks effect”.  My, aren’t we clever.  (forgive the sarcasm)

Advertisements

what is a student?

Today I’ve been thinking a lot about this question.  Here are my thoughts:

A student’s job is to learn.  To try.  To make mistakes.  We are going to mess up.  And that’s the point.  A student needs to be given the space to think, to try, and to get it wrong.  That’s how we learn.

However, of course, this isn’t an all-or-nothing game.  Rather, there is a spectrum between perfection and failure on which each student can be found.  Realize, though, that I’m not referring to grading or performance here.  I’m talking about expectations.  How often is the student expected to reach perfection, or near perfection?  How often is the student allowed to miss the mark?

There is a balance to be sought in this.  The student must be permitted to make mistakes, just not excessively.  If the student is given too much latitude, they will miss out on needed correction and learning.  But if the student is given too little freedom, and is too severely corrected for every error, then the only lesson learned is that of fear — the fear of trying.

The student will learn that the best way to avoid failure is to make no attempt in the first place.  To prevent this, the student must be allowed to make an occasional mistake without the fear of failing an entire class, being held back, or expelled from school.  Only an accumulation of mistakes, or the repetition of prior errors, justifies such drastic punishments.

To use a sports analogy, what would baseball be without three strikes?  Who would (or could) play the game if one swing-and-a-miss was all it took to strike out?  And what would the game be like if one strike was sufficient to eject you from the remainder of the game?  That is why the game has three strikes: to accommodate less than perfection.

I feel like I’m rambling, but this is my point: students are students, and we will mess up.  We’re supposed to.  We need to be held accountable for our mistakes, but not to the same degree as the masters.  Because we’re not masters.  Not yet.  And if we’re not provided an environment in which we can safely attempt to become masters, then we might as well not even try.

At least that’s the lesson we’ll learn.

(Maybe another day I’ll rant about my philosophies on what a teacher is.  I’ll give you a clue: it’s not a simple holder or disseminator of information.  That’s a book’s job.)

HPV = human papillomavirus

Today the CDC expanded its recommendation for the HPV vaccine to boys and young men aged 11-21 years.

Here is my position:

  • HPV can cause cancer; HPV does not cause sex to happen. (If it did, it would be marketed very differently.)
  • Cancer can cause death, sex cannot. True, people can get diseases from sex (including HPV), and those diseases can cause death.  But transmission of those diseases can be minimized and prevented… by things like an HPV vaccine.
  • Therefore, If HPV can cause cancer, and if this can be prevented by a vaccine, then those at risk should get the vaccine if they want to avoid getting cancer.  Either that or guarantee that teenagers won’t have sex.  Good luck with that one.
Now, here are some details about HPV, what it is, and what it does.  This way I can count this as studying, kinda.
  • HPV = human papillomavirus
  • HPV refers to a group of over 100 non-enveloped DNA viruses that use skin and mucosal surfaces for replication
  • only some types (16, 18, 31, 33, 35) can cause cancer (i.e., have oncogenic potential)
  • there are two HPV vaccines: Gardasil protects against four types of virus (16, 18, 6, 11).  Cervarix protects against types 16 & 18 only.  16 & 18 cause about 70% of cervical cancers; 6 and 11 cause about 90% of genital warts.
  • more information can be found here:  http://www.cdc.gov/hpv/

who fits who?

You should know, this post has nothing to do with Uncle Sam.

Today at school we started a new “block”.  (Our curriculum is split up into segments of 8-9 weeks called blocks.  The last one was “Brain & Behavior, and we just started “Circulation, Respiration, and Regulation”.)  Each block is led by different physicians and scientists who specialize in the subject matter being taught, so inevitably there are changes in how things are taught each time we begin a new block.  The great thing about starting a new block, then, is watching a room of about 100 med students become very uncomfortable with the changes.  There are the vocal complaints and audible groans, then the pointed questions from high-strung “type A” personalities asking things like “Why are you moving away from a Board-prep style of teaching,” and “Why are you making it like that other block from last year that we hated so much?”

This got me to thinking:  Is the medical school supposed to alter their teaching style to fit the students, or should the medical students try to adapt to a changing situation?  Who should fit who?  Should the school bend to the student’s demands, or should the students accept it as a challenge and move forward?

My opinion:  the student should accept the challenge from the teachers.  Classically, that’s what education is.  The student has always been challenged by the teacher.  (That’s Socrates to the right — I admit that I don’t know much about him or his methods.)  Rather than complaining that the new way of doing things somehow makes it harder to succeed, the student should say, “Okay, so you’re making it more difficult — I’m going to do well anyway!”  Instead of taking that anxious energy and whining about the status quo, focus that energy and blow every test out of the water.  Look at it as a chance to prove that you can do well regardless of the circumstances; an opportunity to show your true mettle.  Prove that you are so destined to become a physician that you’re going to learn the stuff no matter what tries to get in your way!

I think of this kind of response as the “high road”.  Take whatever hand your dealt and make the most of it.  Take a less-than-ideal situation and do extraordinary things.  The “low road”, on the other hand, is just complaining about how it’s somebody else’s fault that things are hard for you.  Nobody likes a whiner.  And nobody is impressed by somebody who does well when everything is stacked in their favor.  But when somebody does well when it’s not easy, that’s impressive.

So what kind of “somebody” do you want to be?  Personally, I want to be the doer, not the complainer.

patron saint of headaches

If only medicine were this simple.

Have a headache?  Say a little prayer and a saint will bring a magical aged rabbit, place it on your head (which will feel extra nice because of its soft rabbit fur), and your headache will get better… probably.

Instead, nowadays, we spend several years and millions of dollars to figure out what causes headache and then even more time and money developing some kind of therapy.

But, to some people, modern medicine is just as mystical as the anti-headache rabbit idea:

Have a headache? Make a little phone call and a doctor will give you a magical pill, that you place in your mouth (which will feel extra nice because of its sweet coating), and your headache will get better… probably.

Just like magic.

the limerick of syphilis

There was a young man of Black Bay,
Who thought syphilis just went away,
And felt that a chancre,
Was merely a canker,
Acquired in lascivious play.

Now first he got acne vulgaris,
The kind that is rampant in Paris,
It covered his skin,
From forehead to shin,
And now people ask where his hair is.

With symptoms increasing in number,
His aorta’s in need of a plumber,
His heart is cavorting,
His wife is aborting,
And now he’s acquired a gumma.

Consider his terrible plight,
His eyes won’t react to the light,
His hands are apraxic
His gait is ataxic,
He’s developing gun-barrell sight.

His passions are strong, as before,
But his penis is flaccid, and sore,
His wife now has tabes
And sabre-shinned babies,
She’s really worse off than a whore.

There are pains in his belly and knees,
His sphincters have gone by degrees,
Paroxysmal incontinence,
With all its concomitants,
Brings on quite unpredictable pees.

Though treated in every known way,
His spirochetes grow day by day,
He’s developed paresis,
Converses with Jesus,
And thinks he’s the Queen of the May.

research ethics a la facebook

I’m taking a research ethics class right now.  It’s required for certain grants, and it actually teaches some very valuable information about how to properly go about research.  It’s still boring, but good nonetheless.  It’s a small class of about 20 people — mostly residents and researchers.

I typically sit towards the back row, and yesterday I noticed something funny.  Of all the people using laptops, at least 4 of them were looking at facebook during the lecture and everybody else was using email or google.  I thought that this was a phenomenon of people my age and younger, not older people who have real jobs.  I was wrong.

I’m guilty of it too, though.  I’ve been known to take a peek into the book of faces during lulls in lectures, but not in this class.  I don’t feel that using a computer is justified in this class as I take scanty notes.  I usually just sit there with a notebook and write one or two sentences per two-hour session.

The interesting thing was that facebook didn’t seem to distract from class participation or discussion.  We still held a lively discussion about what constituted human-subject research, yada yada yada.

So maybe facebook doesn’t get in the way of learning as some people have suggested.  Well, actually, it probably does.  In either case I suppose it’s disrespectful to the instructors, and you shouldn’t do it — very much.

But at least the younger students aren’t putting thumb tacs on teachers’ chairs and pulling other stupid pranks like they used to.  Nowadays a lot of them are just listless, obese, and apathetic.

Not sure which is better.

salty dreams

The other night I had a dream.  Thing is, I don’t remember much of it.  But I do remember waking up with my face drenched in tears.  What was I dreaming about?!

There’s a theory about dreams that could make some sense out of this.  The basic idea is that dreams allow our minds to simulate dangerous situations in the safety of our sleep.  It’s like a kind of virtual reality training ground where our ancestors could learn how to outwit a saber-toothed cat without actually being confronted by a saber-toothed cat.

So what would my brain have been simulating that would make me cry in my sleep?  I’ve had scary dreams before, sometimes involving large bodies of raging water and/or falling off of ladders (interpretation please?).  But this one was different because I didn’t feel scared — I felt sad.

I think I would rather have the scary dreams about avoiding large predators.  But then again, maybe that’s why my brain simulated something sad instead of something action-packed, exciting, and scary.  The fact that I don’t want to experience it makes it more likely that my mind will simulate it.  Maybe?

Is my brain really using some kind of reverse psychology on itself?  Whoa… I think I just blew my mind.

DNA!

When I was about ten years old I went to see the movie Jurassic Park.  I loved it!  Cloning dinosaurs?!  Awesome!!

In hindsight, I guess I was kind of a geek.  I thought it was just so cool that they had computer screens full of ‘T’s, ‘A’s, ‘C’s, and ‘G’s.  Their “scientists” could just scroll through the genetic code and use it for whatever they wanted.  Pretty sweet.

I was thinking about this today as I was looking up sequences on the internet and copying large numbers of ‘T’s, ‘A’s, ‘C’s, and ‘G’s on my computer screen.  And in the spirit of geeky genetics fun, here’s a contest.

Name the gene that the following sequence encodes.  (Post your answer in the comments. Hint at the end.)

5′-  ATGCTGCTGCTGGCGAGATGTCTGCTGCTAGTCCTCGTCTCCTCGCTGCT

GGTATGCTCGGGACTGGCGTGCGGACCGGGCAGGGGGTTCGGGAAGAGGA

GGCACCCCAAAAAGCTGACCCCTTTAGCCTACAAGCAGTTTATCCCCAAT

GTGGCCGAGAAGACCCTAGGCGCCAGCGGAAGGTATGAAGGGAAGATCTC

CAGAAACTCCGAGCGATTTAAGGAACTCACCCCCAATTACAACCCCGACA

TCATATTTAAGGATGAAGAAAACACCGGAGCGGACAGGCTGATGACTCAG

GTAGGAACCCAGCGCCGGGGCGTGGAATGTGTGGCTTTCCAGGGGGTTAC

GAGAAGCCGAACACTTCCAGACTTAACTCTGTTTGCTCTTCGGGCAGATA

GGAAGGTGATTTCACCCGCTCCTTCCCCACCCACCTGCCCGCCCCCCATC

TCTTCCTCTTCCTGGAGGAGAATGGAGGTCAAGGGTCCAGCTGGAGAAGT

TTAGGGTGTGGTGGGGGTGAGGACGGTAACAGACGTGGTTCATTATGGCC

CTGATTTGATGAGTCTTGCTACAATGGCCTTCCCCATCCTACCTCTGCCC

TGGCTTGTAACTTGGGGAGACCTTCACTTTGGGGGCGTCGGCCCTTTCCA

AGTCAGGAGTGGAAATGGAAGGAGAGGCTGGGAATCCCCCTCCCACAAAC

ATGAAGTGGTCTCCTGGTACTGTACGAACGAACGAACGTAGCCTTGGGCA

TTGGAGCTCAGAGCCCCCACGTTTCCCGTTGCCTCTGTGGTTTTCTTTCC

CACCACTACCCCCACCCTGCACCTCCCCACCAAAGAATTCTCAACTGGAA

AAGCCAGGAGGCGGTTCTGACAAAAGGCAGGGGCTCCAGGGGAGACTCCG

CCCGTCCCTGGGTGGCTGGCTGTATCGCAGAGCTGGCTTTGCGATTGCGT

GTCCGCAATTGTGCCCATCAGAGTGTGAATGTATTGATATTTCTTTAAGG

ATGCTCTTTCGTTCTTCCAAGCCCGAGGTACCTTAGGGGAGGGACTTAGA

ACTTATTGGCATTGCATCACTTTAGTTTTCAACCTGCTTGCATAAGAATT

AAGAGCGAATAAATATTAGTGTGGGGGGAGGGGAAGCTAAGCAAAATATG

AATTCCTCTCTCTCTCCCCACCTCCTTTGAGATTTCTGAGCTGCCAATCT

CCCAGCCAATTCTAGACTTTCTGAAACTCCATGCACGTATAACTGAAGCC

AGAAATGGGTTTCCTTGCAAATATAGGTCAACATCCTTTTTATTGCCCTA

TTAAAATATTCAAGTCCTACCTTTAGGGCTAGGTGCGTACAGCGGCTGAT

GGAGTGGCGCTGGTGGGGCGCAAGTGCAGGGGGAGGGTACTGACGGCAGA

GAGAGAGGAGCTACCTCCGTGCCGCCCTGCTTCCCGACCCGATTCCCAGG

CTTGCTTGAGGCCGAGAAAGGCGAGGGGCAGGCAAGGTAGCCTGCTCCAG

CTGTCGGAAGGGAGAGGAATGGGAAATGGTCCTGATTTCCTTGCTCTCCC

TCATCTGCTCCCGACCACCTTAAATCTGGACCGCGAGTGTGGACGCGCGC

GCCAGTGCCAGACAGCAGCGCGATCCACAATTAACTCTGCACGGGCCATG

GGGTGCCCGTTGCGTGCAGCTGGCTGGAGGGAGTTCTCCGGCTAGCCCGA

GGCGCCCATCCTCTCGTCACCCTCACTCCCCGCGGAGGAGGGGCCTTGCC

AGGGTCCCTCGGAACCCGAGAGGAGGGAGGCACTGCGGAGAGAGCGGCGG

GGGCGTGGATACCCGAGGTCCCAGAGCCAGAGTGGGTCAGCTTCTGCCCT

GCTCTGCGGGAGGCCAATACCGCAGAAGGGGTCCTGGGCTCGCACACCTT

CCCAGGGCTTGGGCCTTGCAGCCCTGCTGCAAAGCTGCAAGCGCACAGAG

CCGCGCAGCGAGGCAGACGCCTGCAGCCCCACTTACTCCCGGGTTATCGA

TCCCCCGCGGCTAGGGTTTCAGTGCGCGAGGGGCTGGGCTGGAGCCGCCG

GGCTCTGCTGCTCCACGCGCGGGAGCGCAGGCACCGCAGGAGCTAACAGC

AGCGCCGGGCTCGCTGTAGTGTCCCCGGCGGCGGGGGCGCGGAGATGGGG

GCGCCCGCGCAGGGGCCGGGGCGCATCGCGGGCTCCGCCGGCCTGCCCTG

GGACGCGCCCCCATCCCCAGTCCGCCGCCTGCCTGGCCTCTAGGCCTCCG

CGTCCCAGCCGGAGCCCCCAGCCCGGGGGCCTCCCCCCGACCCCCGTCCG

CCCTGCCGGGGGACGCAGGGCCCAGCGGCCCCGCGCCCGGCCACTCTCGC

CGCCGCGCGCACAGGCAGCATTTGAACTTCTGACCTTCTGTCAACTTCCC

TCAGACGAACGAAACGAAAACAAATACTTTTTTCCTTGGGCAGTGGCTAT

TCCCGTTCCCAACACAAAAGGAGGGGGAAGGACGGCCCAAGTGGGGGTTG

GGTGAGGAGAGCCAGGCCGGGATTATCAGGCAGACCCCACAAAGGTCCCC

TAAAACCGAGGGGGGTAGGGGCTGGCAGTCTGTGAGGTATCCCCGGTTGA

TCCCTCCCCTACCTTCCTTCTCCCGATTCCAGGAGTTAAGGGTGGGGGAG

GAAGGGATGGGGAAGGCGGAGGCTCGGGTGCTGAGGGCAGGGGCGGGGTG

CAGGAGGCGGCAGGGGAGCCCCAGGCCGGCGGGAGGTTTGGGGAGCCTGC

TCGGCCGCCCTCATTTTAAATAACCACCTAGGCTCTGCCCCAGGTGCGTG

ACCCTCTTCTTCTGTCTCCCTCCCTGTCTCTGGGTCTCTAATGTGACTGC

CGCCCAAGTCCCTCAACCATGGCGAGATCGTCCCCAGTGGAACTTTCGGA

GCAGTTCCGGAACGCAGGAGCTGCCGGTTAATATTAACCCGGGAGAGGAA

AGCGCAGACAGACACGCTCTCCCCGCGCGGGCCTAGGTGCCAGGCGAGGG

TGCTGGCGGCCAGGGGGCTCCTAAGGGGCAGGAGGCCAGAGGGCCGGATC

TGAAGCCTGGAGTGGGGTCCCGAGCCGCTACACTAAATAGATTTAATGTG

CGCTCTGGGGCCGCCAGGAAAGACGCTCAGGTATGGGGTTGGGGAGGGGC

TGTTCCACCAAGCTTGGGGGAAAGGACAGTGGAGAGAGGTGCGTTTAGGG

GCTGGGGCTGTCTTGAAGCTGGGACGCCCCCGCCCCCGCGCTGGGGGAAG

CCCACCGGCTGCTGGCGGTGACACTCGCCGGCGCGGCTCGCAGATCAGGG

AGGTAGGCGGGAGCTCAGGCGTGGGGAACAACTTGGCCTCCGCCGACACA

AAGCCCGGCCCCGGCGGCCCTGCTGGGCTTCACGGTGGCTGCACAGAGTC

GGGCTTGATTCGCGGCACACGACCCAATGAATTAATAACCGGCCTGGGCT

TCCCGGCTTTGCCTGCGACAATCCCGCCCAGCGCGGGCGGAGGAGAGGCC

GCCAGCCGAGGCCGCGCGGAGCCCGGGCCGGAGGAGGGCGCAAGGGGCGG

GGGCGCCAACTCCAGCAACCCTCGGCCTCCGCCCCTCACTCGCGCAGCCA

CCTCCCGTCGCGGCCCGGCTGGACCCGGGTCTCCCTGCCCGGGGTCCTCC

ATGCCTGCCCAAGTGGCGCAGCTCACAGAGCTGGGGGCCAGGTCATCCTC

ACCCTGCCGCCCTCTCCCTGGCTGCCCTCCTGGGAAGCTGTTTAAAGCTT

CTTCGGCACAGCCCCAGGGGAGGGAGCTGCGGTGGGGTGGGGGGCTTGCA

TGGGGGTCCCTGTGCGTGTTGGTGGTGTGCGCCTGCGCGCAACGGGCCTC

ACATCATAGCTCTACACTGACCCTGGTTTACTGATTGATTTTCATGTAAA

ACGCGTTCAATCCTCAAGATGACCTCACTCAAACTCTGCCCTTCCGACTT

TTTTTTTTAACTGCTGGCAGGCCCACAAACATGCAGGCACTGACCTGTTA

CCAGGGCGGCCCCCAGCCCTACCCCACCCCCAGTTGTTGCATGTTGAACT

CTACAACCATATTACTGGGTTTTATTGCTGCCAGATACACAGGACTTTTC

CTGTTGCGCAATTTGTCACGTCCCCTTAAAGCGCCGCAGCAGTGGGGCCA

GCGTCCTCGCCCCACCCTCTCGAAAGAGTCCCCCCAACCCACGCTACAGT

TAGGGCCCTGGATAGAAGCTGTCCCTCCATGGCGACAACCAGACTCCAAG

CAGAGCATCCTTCCAGACTGGAGGAGGTTAGAGGTCAGCCCCGCCCTCTG

CAGAAGTCACCTTGAAATTGCCCCTCGGCCTCCACTTGGCGCAGCTTCTT

GGGGGATGCCACCATCGTCATCTGTGCCAGTTCCCCCTCTTTAAATCCCA

TGTCCCACCAGCAGCAGCAGGGTAAACATCCAGGAAGCAAGTCAGTGCCC

CCACAAACACACACAGTGGATTCAACTGCTTTCTGTCGCATCCTTATCTG

AGGGTGACCCCAGAATTCCAGGGGAACCCCCACAATCTGAATCCCAGGTA

ACCCCGTCTGCATCTGCCTAGTCAGTGTTTCCTGCCTCCTCCCAGGCAAC

TTCCTGGGAAACTCCCCAGGCGGAGGACTCCGAGACCTCAGGCCTTCCTG

TCTCCCCTCCCCCTCCTCTCAAACCCCTCCCCCTCCCTCCACCTCTTCAG

TTTGCTCTTCAAACTTGCTGGACGCCATTCTATGCTGGGGCCAAGAACAC

AAGAGCGGAGGAAGGGAACAGGTTAAAGAAAACAAGAAACACAATCAGAC

CACAGAAAAGCCAGGCAGAAAAGGGTTCGACGGGCAAAAAGAATGTGGCT

GTCCAGATAAAGAATGTCTGTCCCGGCCCCGGCCTGTGCTGCAAGTGGCA

ACTCACCTAGCCGCCTGCCACCCAGGCTCCCGCCCACCGCGCAGCCCCGC

CAGCGGCTTCTCGCCTCCCCTCTGCCTCGGATAGGGTTAGGGCCTGAGGT

AAATAAATGCAAGGCCTTCAATTCTCCAAGCAGTGCGCAGTGCATTTTTC

TTTATTTCTGGGAACTTGCGCCCAGGTCTCTGTCAGGCCTGCTGTGAGGG

ATTCTACGCGGGGAGAAGGTGGAGGCTGCGCAGGTGGAGAAAGGGGCCCC

AGAAGGGGGGCTAGAAGTGGAGGGCAACGTGGGGGCGGGGCGGGTATCCC

AGAGGGTGCCCCTGGAGGGTCCTGTAGTTGATGTCTTAAACATGCAGGTC

ACTTGTTTCAGAGAAACTTTATTTGCTTCTTAGGCCTCGCTAGGAGCATC

GGCTGTTTCAGGACCTGGAGAAAGGCCCCCAGCTCTACCCTGAGAGGACG

TGCTCCTCCACGCTCCTCCGCAAATGCTGTCCCTCTTCCCCAGCCCAGGG

CCCGGCTCTTCGGTGTGTCTGGGCCATTCCAACCCCCGTCTCCCCACCTC

TCCGCATGGCCCTCGCGCCTTGAGACTGGGCAGGGCAGGCTGATGGAGGG

GCCGGGAGGGGTGGCGGTTGCCCAGGCTAACGTGTCCGTCGGTGGGGGTC

CCCTTGTCTTCGCAGAGGTGTAAGGACAAGTTGAACGCTTTGGCCATCTC

GGTGATGAACCAGTGGCCAGGAGTGAAACTGCGGGTGACCGAGGGCTGGG

ACGAAGATGGCCACCACTCAGAGGAGTCTCTGCACTACGAGGGCCGCGCA

GTGGACATCACCACGTCTGACCGCGACCGCAGCAAGTACGGCATGCTGGC

CCGCCTGGCGGTGGAGGCCGGCTTCGACTGGGTGTACTACGAGTCCAAGG

CACATATCCACTGCTCGGTGAAAGCAGGTAAGCTGGCCCTGGCCCCCCGG

ATCCGACCCAAGGAAGGCCATTGGCGCACCTCGGCTTGATTCAAGAGAAA

AAGAAACCTGGGGGGAGGCTGAGGGCCAGGAGCAGGGTCGCTGGGCGATG

ACTGCGTTTCCGCGGTGGAACCTGCCCTGTGAGGTGCCGGCCCCTCGAAA

TCACCCCTACCTTTGAGGCCACAGAGCCCAAGGTTCTCCATGCCCCGAGA

TGGGGTCCTGTGGCTTCCTGCCCGCTTCTGGAGCCCCCACTGCAGGGGGT

GGGAAAGCGTGACTGGGGGAGGGGCGCTAGGCCCTTCCAGGCGAGGGAAG

ACAGCCCTGCGCGGTTAGCCAGGTCTGGGCGAGCTCCTTCCTCTCGTTTA

GGGCTTAAGAACCAACCGCCCCCACCCGCTATCCCAAGCGCAGGGGTGTC

TATCCTGCCCCGGAGCCCGCGTCCTGGCTCCTCCCCGCCGGGCGCCCGTG

GATCCTAAGCTGCCTTTGGGGAGAGGCCTGGTGGGCGGCAGTAAACCCAG

GGGCAACCACCTCCAGCATCTGGAGGCGGCGCGCCCGGAGCCTGCGTTCC

TACTGGGAGCCGGGCCGGGACGCCCTGGGCGGCGGGCAGGCCCCGAAACG

CCGGCCCGAGTCGGCGCGAGGCTGTCTTCTCTGGGCCTGCAACGCCACAC

GCTGTTGCCGGCGAGGAACAGCCGTGGAGGAGGCGCCATCGCGCGCACGC

AAACCTCCGGCCCGAGGCTGTGTGCACAGCGCTCTTCTCCGCCCGCATAA

ATTGGCACGTTTAGCAAAGCCGTTCACGGTGAATTTCGGGGAAACTCTGC

CTTCCTCAACCCCCTTCCAGGCTTCCCTACTTGTCTCCTAAATTCCATGT

TAATGGCACTATGTTAGTAGGAAAACACTGTTAAGGTGTCAAGGCACACT

TGTAGGTAAAGGCTAGAGTGGCTTCTCGTCCCCACAGAAAGCAAAGGCGT

GGAGCGGGGGCGGCAGGGGCGGGTGTGCGGCCCGGAGAGCTCCCGGCTGC

AGGCAGGCAGGAGGCGGCGCCCCCACCTCGCGGGCTCGGCGGCGGCCCCT

GGGCCCAGGGCGCCCCCTGCGCAAAACCTCCTCCCCGGCTCCCTGCCCGC

GGGGTCCCCCTAGCGGGGGTCTCCGGAGGCCTCCTCCCAAGTGAGCAGCG

CTAATCCATCCCCCGGATCGCGCCGGGAGAGCGGAGCCGCGGCGCGGGAG

CCGCTCATTGGCATTCTGAGCACACGGGCGGGGGCGCGGGGCGCAGCGTG

TCAAGCCGGGCCGTGCGACTCGACGACTCGGGCTCGCCAGCGCCCGGGGT

CGCATTCCGGGGGGCTACGGAGGGCCTCCAACGGCCAGCCCCGCACTTCA

TGCCAGAGAAACCGATGAGAAGATTAAAAGCCCCCTGTAATTCCAGCAGG

AAGATTCTTTCTGGCAATCTCTATTTGCAAAAAGCATGATCCCGGAGATT

GGAATGCAAAGAAGACGGCCCTCCCCGCCCTCCTCCCCGGCCCCCTGCGC

TCCGCCCCAACTTCAATTATTGTCCTGGGGACAGTGAGCCTCAGAGAGCG

ACAGAGGGCTCGAGAAAGCGGGTAGTCAAGGGGCCTTGAGACCCGGCGCT

TCCAGCGCTCCGAACAGGCCCCGCCATTTAAAATTCAAATACACATCTTG

AGTGCTTGGAAGAGAGGCCTGGCTGTGCAAATAGTGCTTGTGAATTGCAC

ACGGGGTGGGGGGGGGTTGCACCTGAGCAAATAGGGAGGGGGAGGCCCGC

GAGCTGGGGAGAGAGTGAGCTGAGAACAGGGAGGGGAGAAAATGGAAGTG

TCCCCTTCCAAGAGTGTCTCCTGTTTATCCCAGAAATCACAATGACAATG

CTGGGCCCTTTATTGGATTTTAATTAGAAAATCCACACAAGCCTCGGATT

TTCACACCTCGGCCAATCTCTGGAATGTTTGTCCAGTTGCTACAACTACT

GCAGCTATTTTTCACTCCCCGCCCCCGCCCCTCCGCAGGCCCACGCCGAG

GCGCGGCAGGGTGCTGCGGGCAGGCGGGCAGGCGGGCAGGCGGGCCAGGG

GTTTCCGCCGCGCAGCCCGGGTGCTGAGTGCGCGAGCAGGCGCCGCGCCC

CGCGCCGGGGCGGGAGGGAAGGAGGGTGCGCCCGGCGCCCGCGGGAGCTC

AAGGAGGCTTCCTGAGGAATCCAAGTGCAGAGCAAACACCCTCTGGATGG

ATTCGCGGCGAGGCCGGGTGTGTGCGGAGCTGGGGGTGGGGTTGGAGGAA

GGCGGAAGGAAAGAGTGTCACCGGCCTCTGCAGGAAACGCCAGCCAACCT

CTGTGACCGCCAGCCCAGACTTAGAGAGTCGTTAAGGAATGTGTCGGAAT

CCTGTCCCTGGGGCAGTGGGGTTGGGGGAGGGAGGTGTGTGCGGGACCCG

CCTGGAATCAATCGCCCCGCCCCGCGCCTTGCGCACCCCTGGCCTAGGAG

CGCGGGCACCAAGCGTGCGCCCTCCTCCCCGAGACGCGCCTCCCTCTCGG

AACTCAATGCCCTGTCCTCTCTTCTTTCCCTTCTCCTCACCCGCAGAGAA

CTCGGTGGCGGCCAAATCGGGAGGCTGCTTCCCGGGCTCGGCCACGGTGC

ACCTGGAGCAGGGCGGCACCAAGCTGGTGAAGGACCTGAGCCCCGGGGAC

CGCGTGCTGGCGGCGGACGACCAGGGCCGGCTGCTCTACAGCGACTTCCT

CACTTTCCTGGACCGCGACGACGGCGCCAAGAAGGTCTTCTACGTGATCG

AGACGCGGGAGCCGCGCGAGCGCCTGCTGCTCACCGCCGCGCACCTGCTC

TTTGTGGCGCCGCACAACGACTCGGCCACCGGGGAGCCCGAGGCGTCCTC

GGGCTCGGGGCCGCCTTCCGGGGGCGCACTGGGGCCTCGGGCGCTGTTCG

CCAGCCGCGTGCGCCCGGGCCAGCGCGTGTACGTGGTGGCCGAGCGTGAC

GGGGACCGCCGGCTCCTGCCCGCCGCTGTGCACAGCGTGACCCTAAGCGA

GGAGGCCGCGGGCGCCTACGCGCCGCTCACGGCCCAGGGCACCATTCTCA

TCAACCGGGTGCTGGCCTCGTGCTACGCGGTCATCGAGGAGCACAGCTGG

GCGCACCGGGCCTTCGCGCCCTTCCGCCTGGCGCACGCGCTCCTGGCTGC

ACTGGCGCCCGCGCGCACGGACCGCGGCGGGGACAGCGGCGGCGGGGACC

GCGGGGGCGGCGGCGGCAGAGTAGCCCTAACCGCTCCAGGTGCTGCCGAC

GCTCCGGGTGCGGGGGCCACCGCGGGCATCCACTGGTACTCGCAGCTGCT

CTACCAAATAGGCACCTGGCTCCTGGACAGCGAGGCCCTGCACCCGCTGG

GCATGGCGGTCAAGTCCAGCTGA  -3′

(HINT:  This gene was named after a video game that was also popular around the time I was 10.)

toilet pager

Do you wear a pager?  Ever noticed how when you go to the bathroom the pager just seems to be laser guided directly into the toilet?  Seriously!

You undo your belt and start to move things in the desired direction, and the next thing you know… KerPlunk!!!  You swing around and to your horror the weight of the pager has forced your belt to come out of the belt loops, and the pager has flown directly into the dirty waters.  (Hopefully the waters aren’t too dirty yet…  anyway…)

Next comes the terrifying moment of reckoning.  You stare at it sitting there on the bottom of the porcelain sea, tiny bubbles streaming out of it, and you think to yourself:

“Do I grab it, or should I try and get a stick or something?  If I wait too long it’ll be ruined.  Maybe if I grab it fast I can save it.  Yup… gotta grab it.  I can scrub my hands after.  Okay.  Ready.  GO!”

So you reach in and you grab the pager.  It’s a little surprising how much it splashes – you must have grabbed it more quickly than you thought.  And now you’re standing there, pants around your ankles, looking at yourself in the mirror, holding a soaking wet toilet pager in your hand.

You look at it.  The screen is dead.  Crap!  You grab a towel and wipe it off, shake out some of the water that got inside, and towel it off again.  Oh!  Take out the battery!  That might help.  It’s probably still okay.  It’s just got to dry out.  Right?

Now what?  Oh yeah!  Wash your hands!!  Now quick, pull up your pants and go google “toilet pager”!  With the towel-covered pager in hand you move with purpose to the computer.  To your surprise (or not) there’s actually a large amount of information on the subject.

RICE!  That’s the answer!  Bury the pager in a bowl of uncooked rice and wait for like 2 days.  Okay… you have a plan… everything’s going to be all right… take a breath.

Now… back to the bathroom to finish the business that you had initially set out to take care of.  …Maybe leave the cell phone behind.