HPV = human papillomavirus

Today the CDC expanded its recommendation for the HPV vaccine to boys and young men aged 11-21 years.

Here is my position:

  • HPV can cause cancer; HPV does not cause sex to happen. (If it did, it would be marketed very differently.)
  • Cancer can cause death, sex cannot. True, people can get diseases from sex (including HPV), and those diseases can cause death.  But transmission of those diseases can be minimized and prevented… by things like an HPV vaccine.
  • Therefore, If HPV can cause cancer, and if this can be prevented by a vaccine, then those at risk should get the vaccine if they want to avoid getting cancer.  Either that or guarantee that teenagers won’t have sex.  Good luck with that one.
Now, here are some details about HPV, what it is, and what it does.  This way I can count this as studying, kinda.
  • HPV = human papillomavirus
  • HPV refers to a group of over 100 non-enveloped DNA viruses that use skin and mucosal surfaces for replication
  • only some types (16, 18, 31, 33, 35) can cause cancer (i.e., have oncogenic potential)
  • there are two HPV vaccines: Gardasil protects against four types of virus (16, 18, 6, 11).  Cervarix protects against types 16 & 18 only.  16 & 18 cause about 70% of cervical cancers; 6 and 11 cause about 90% of genital warts.
  • more information can be found here:  http://www.cdc.gov/hpv/
Advertisements

patron saint of headaches

If only medicine were this simple.

Have a headache?  Say a little prayer and a saint will bring a magical aged rabbit, place it on your head (which will feel extra nice because of its soft rabbit fur), and your headache will get better… probably.

Instead, nowadays, we spend several years and millions of dollars to figure out what causes headache and then even more time and money developing some kind of therapy.

But, to some people, modern medicine is just as mystical as the anti-headache rabbit idea:

Have a headache? Make a little phone call and a doctor will give you a magical pill, that you place in your mouth (which will feel extra nice because of its sweet coating), and your headache will get better… probably.

Just like magic.

research ethics a la facebook

I’m taking a research ethics class right now.  It’s required for certain grants, and it actually teaches some very valuable information about how to properly go about research.  It’s still boring, but good nonetheless.  It’s a small class of about 20 people — mostly residents and researchers.

I typically sit towards the back row, and yesterday I noticed something funny.  Of all the people using laptops, at least 4 of them were looking at facebook during the lecture and everybody else was using email or google.  I thought that this was a phenomenon of people my age and younger, not older people who have real jobs.  I was wrong.

I’m guilty of it too, though.  I’ve been known to take a peek into the book of faces during lulls in lectures, but not in this class.  I don’t feel that using a computer is justified in this class as I take scanty notes.  I usually just sit there with a notebook and write one or two sentences per two-hour session.

The interesting thing was that facebook didn’t seem to distract from class participation or discussion.  We still held a lively discussion about what constituted human-subject research, yada yada yada.

So maybe facebook doesn’t get in the way of learning as some people have suggested.  Well, actually, it probably does.  In either case I suppose it’s disrespectful to the instructors, and you shouldn’t do it — very much.

But at least the younger students aren’t putting thumb tacs on teachers’ chairs and pulling other stupid pranks like they used to.  Nowadays a lot of them are just listless, obese, and apathetic.

Not sure which is better.

salty dreams

The other night I had a dream.  Thing is, I don’t remember much of it.  But I do remember waking up with my face drenched in tears.  What was I dreaming about?!

There’s a theory about dreams that could make some sense out of this.  The basic idea is that dreams allow our minds to simulate dangerous situations in the safety of our sleep.  It’s like a kind of virtual reality training ground where our ancestors could learn how to outwit a saber-toothed cat without actually being confronted by a saber-toothed cat.

So what would my brain have been simulating that would make me cry in my sleep?  I’ve had scary dreams before, sometimes involving large bodies of raging water and/or falling off of ladders (interpretation please?).  But this one was different because I didn’t feel scared — I felt sad.

I think I would rather have the scary dreams about avoiding large predators.  But then again, maybe that’s why my brain simulated something sad instead of something action-packed, exciting, and scary.  The fact that I don’t want to experience it makes it more likely that my mind will simulate it.  Maybe?

Is my brain really using some kind of reverse psychology on itself?  Whoa… I think I just blew my mind.

DNA!

When I was about ten years old I went to see the movie Jurassic Park.  I loved it!  Cloning dinosaurs?!  Awesome!!

In hindsight, I guess I was kind of a geek.  I thought it was just so cool that they had computer screens full of ‘T’s, ‘A’s, ‘C’s, and ‘G’s.  Their “scientists” could just scroll through the genetic code and use it for whatever they wanted.  Pretty sweet.

I was thinking about this today as I was looking up sequences on the internet and copying large numbers of ‘T’s, ‘A’s, ‘C’s, and ‘G’s on my computer screen.  And in the spirit of geeky genetics fun, here’s a contest.

Name the gene that the following sequence encodes.  (Post your answer in the comments. Hint at the end.)

5′-  ATGCTGCTGCTGGCGAGATGTCTGCTGCTAGTCCTCGTCTCCTCGCTGCT

GGTATGCTCGGGACTGGCGTGCGGACCGGGCAGGGGGTTCGGGAAGAGGA

GGCACCCCAAAAAGCTGACCCCTTTAGCCTACAAGCAGTTTATCCCCAAT

GTGGCCGAGAAGACCCTAGGCGCCAGCGGAAGGTATGAAGGGAAGATCTC

CAGAAACTCCGAGCGATTTAAGGAACTCACCCCCAATTACAACCCCGACA

TCATATTTAAGGATGAAGAAAACACCGGAGCGGACAGGCTGATGACTCAG

GTAGGAACCCAGCGCCGGGGCGTGGAATGTGTGGCTTTCCAGGGGGTTAC

GAGAAGCCGAACACTTCCAGACTTAACTCTGTTTGCTCTTCGGGCAGATA

GGAAGGTGATTTCACCCGCTCCTTCCCCACCCACCTGCCCGCCCCCCATC

TCTTCCTCTTCCTGGAGGAGAATGGAGGTCAAGGGTCCAGCTGGAGAAGT

TTAGGGTGTGGTGGGGGTGAGGACGGTAACAGACGTGGTTCATTATGGCC

CTGATTTGATGAGTCTTGCTACAATGGCCTTCCCCATCCTACCTCTGCCC

TGGCTTGTAACTTGGGGAGACCTTCACTTTGGGGGCGTCGGCCCTTTCCA

AGTCAGGAGTGGAAATGGAAGGAGAGGCTGGGAATCCCCCTCCCACAAAC

ATGAAGTGGTCTCCTGGTACTGTACGAACGAACGAACGTAGCCTTGGGCA

TTGGAGCTCAGAGCCCCCACGTTTCCCGTTGCCTCTGTGGTTTTCTTTCC

CACCACTACCCCCACCCTGCACCTCCCCACCAAAGAATTCTCAACTGGAA

AAGCCAGGAGGCGGTTCTGACAAAAGGCAGGGGCTCCAGGGGAGACTCCG

CCCGTCCCTGGGTGGCTGGCTGTATCGCAGAGCTGGCTTTGCGATTGCGT

GTCCGCAATTGTGCCCATCAGAGTGTGAATGTATTGATATTTCTTTAAGG

ATGCTCTTTCGTTCTTCCAAGCCCGAGGTACCTTAGGGGAGGGACTTAGA

ACTTATTGGCATTGCATCACTTTAGTTTTCAACCTGCTTGCATAAGAATT

AAGAGCGAATAAATATTAGTGTGGGGGGAGGGGAAGCTAAGCAAAATATG

AATTCCTCTCTCTCTCCCCACCTCCTTTGAGATTTCTGAGCTGCCAATCT

CCCAGCCAATTCTAGACTTTCTGAAACTCCATGCACGTATAACTGAAGCC

AGAAATGGGTTTCCTTGCAAATATAGGTCAACATCCTTTTTATTGCCCTA

TTAAAATATTCAAGTCCTACCTTTAGGGCTAGGTGCGTACAGCGGCTGAT

GGAGTGGCGCTGGTGGGGCGCAAGTGCAGGGGGAGGGTACTGACGGCAGA

GAGAGAGGAGCTACCTCCGTGCCGCCCTGCTTCCCGACCCGATTCCCAGG

CTTGCTTGAGGCCGAGAAAGGCGAGGGGCAGGCAAGGTAGCCTGCTCCAG

CTGTCGGAAGGGAGAGGAATGGGAAATGGTCCTGATTTCCTTGCTCTCCC

TCATCTGCTCCCGACCACCTTAAATCTGGACCGCGAGTGTGGACGCGCGC

GCCAGTGCCAGACAGCAGCGCGATCCACAATTAACTCTGCACGGGCCATG

GGGTGCCCGTTGCGTGCAGCTGGCTGGAGGGAGTTCTCCGGCTAGCCCGA

GGCGCCCATCCTCTCGTCACCCTCACTCCCCGCGGAGGAGGGGCCTTGCC

AGGGTCCCTCGGAACCCGAGAGGAGGGAGGCACTGCGGAGAGAGCGGCGG

GGGCGTGGATACCCGAGGTCCCAGAGCCAGAGTGGGTCAGCTTCTGCCCT

GCTCTGCGGGAGGCCAATACCGCAGAAGGGGTCCTGGGCTCGCACACCTT

CCCAGGGCTTGGGCCTTGCAGCCCTGCTGCAAAGCTGCAAGCGCACAGAG

CCGCGCAGCGAGGCAGACGCCTGCAGCCCCACTTACTCCCGGGTTATCGA

TCCCCCGCGGCTAGGGTTTCAGTGCGCGAGGGGCTGGGCTGGAGCCGCCG

GGCTCTGCTGCTCCACGCGCGGGAGCGCAGGCACCGCAGGAGCTAACAGC

AGCGCCGGGCTCGCTGTAGTGTCCCCGGCGGCGGGGGCGCGGAGATGGGG

GCGCCCGCGCAGGGGCCGGGGCGCATCGCGGGCTCCGCCGGCCTGCCCTG

GGACGCGCCCCCATCCCCAGTCCGCCGCCTGCCTGGCCTCTAGGCCTCCG

CGTCCCAGCCGGAGCCCCCAGCCCGGGGGCCTCCCCCCGACCCCCGTCCG

CCCTGCCGGGGGACGCAGGGCCCAGCGGCCCCGCGCCCGGCCACTCTCGC

CGCCGCGCGCACAGGCAGCATTTGAACTTCTGACCTTCTGTCAACTTCCC

TCAGACGAACGAAACGAAAACAAATACTTTTTTCCTTGGGCAGTGGCTAT

TCCCGTTCCCAACACAAAAGGAGGGGGAAGGACGGCCCAAGTGGGGGTTG

GGTGAGGAGAGCCAGGCCGGGATTATCAGGCAGACCCCACAAAGGTCCCC

TAAAACCGAGGGGGGTAGGGGCTGGCAGTCTGTGAGGTATCCCCGGTTGA

TCCCTCCCCTACCTTCCTTCTCCCGATTCCAGGAGTTAAGGGTGGGGGAG

GAAGGGATGGGGAAGGCGGAGGCTCGGGTGCTGAGGGCAGGGGCGGGGTG

CAGGAGGCGGCAGGGGAGCCCCAGGCCGGCGGGAGGTTTGGGGAGCCTGC

TCGGCCGCCCTCATTTTAAATAACCACCTAGGCTCTGCCCCAGGTGCGTG

ACCCTCTTCTTCTGTCTCCCTCCCTGTCTCTGGGTCTCTAATGTGACTGC

CGCCCAAGTCCCTCAACCATGGCGAGATCGTCCCCAGTGGAACTTTCGGA

GCAGTTCCGGAACGCAGGAGCTGCCGGTTAATATTAACCCGGGAGAGGAA

AGCGCAGACAGACACGCTCTCCCCGCGCGGGCCTAGGTGCCAGGCGAGGG

TGCTGGCGGCCAGGGGGCTCCTAAGGGGCAGGAGGCCAGAGGGCCGGATC

TGAAGCCTGGAGTGGGGTCCCGAGCCGCTACACTAAATAGATTTAATGTG

CGCTCTGGGGCCGCCAGGAAAGACGCTCAGGTATGGGGTTGGGGAGGGGC

TGTTCCACCAAGCTTGGGGGAAAGGACAGTGGAGAGAGGTGCGTTTAGGG

GCTGGGGCTGTCTTGAAGCTGGGACGCCCCCGCCCCCGCGCTGGGGGAAG

CCCACCGGCTGCTGGCGGTGACACTCGCCGGCGCGGCTCGCAGATCAGGG

AGGTAGGCGGGAGCTCAGGCGTGGGGAACAACTTGGCCTCCGCCGACACA

AAGCCCGGCCCCGGCGGCCCTGCTGGGCTTCACGGTGGCTGCACAGAGTC

GGGCTTGATTCGCGGCACACGACCCAATGAATTAATAACCGGCCTGGGCT

TCCCGGCTTTGCCTGCGACAATCCCGCCCAGCGCGGGCGGAGGAGAGGCC

GCCAGCCGAGGCCGCGCGGAGCCCGGGCCGGAGGAGGGCGCAAGGGGCGG

GGGCGCCAACTCCAGCAACCCTCGGCCTCCGCCCCTCACTCGCGCAGCCA

CCTCCCGTCGCGGCCCGGCTGGACCCGGGTCTCCCTGCCCGGGGTCCTCC

ATGCCTGCCCAAGTGGCGCAGCTCACAGAGCTGGGGGCCAGGTCATCCTC

ACCCTGCCGCCCTCTCCCTGGCTGCCCTCCTGGGAAGCTGTTTAAAGCTT

CTTCGGCACAGCCCCAGGGGAGGGAGCTGCGGTGGGGTGGGGGGCTTGCA

TGGGGGTCCCTGTGCGTGTTGGTGGTGTGCGCCTGCGCGCAACGGGCCTC

ACATCATAGCTCTACACTGACCCTGGTTTACTGATTGATTTTCATGTAAA

ACGCGTTCAATCCTCAAGATGACCTCACTCAAACTCTGCCCTTCCGACTT

TTTTTTTTAACTGCTGGCAGGCCCACAAACATGCAGGCACTGACCTGTTA

CCAGGGCGGCCCCCAGCCCTACCCCACCCCCAGTTGTTGCATGTTGAACT

CTACAACCATATTACTGGGTTTTATTGCTGCCAGATACACAGGACTTTTC

CTGTTGCGCAATTTGTCACGTCCCCTTAAAGCGCCGCAGCAGTGGGGCCA

GCGTCCTCGCCCCACCCTCTCGAAAGAGTCCCCCCAACCCACGCTACAGT

TAGGGCCCTGGATAGAAGCTGTCCCTCCATGGCGACAACCAGACTCCAAG

CAGAGCATCCTTCCAGACTGGAGGAGGTTAGAGGTCAGCCCCGCCCTCTG

CAGAAGTCACCTTGAAATTGCCCCTCGGCCTCCACTTGGCGCAGCTTCTT

GGGGGATGCCACCATCGTCATCTGTGCCAGTTCCCCCTCTTTAAATCCCA

TGTCCCACCAGCAGCAGCAGGGTAAACATCCAGGAAGCAAGTCAGTGCCC

CCACAAACACACACAGTGGATTCAACTGCTTTCTGTCGCATCCTTATCTG

AGGGTGACCCCAGAATTCCAGGGGAACCCCCACAATCTGAATCCCAGGTA

ACCCCGTCTGCATCTGCCTAGTCAGTGTTTCCTGCCTCCTCCCAGGCAAC

TTCCTGGGAAACTCCCCAGGCGGAGGACTCCGAGACCTCAGGCCTTCCTG

TCTCCCCTCCCCCTCCTCTCAAACCCCTCCCCCTCCCTCCACCTCTTCAG

TTTGCTCTTCAAACTTGCTGGACGCCATTCTATGCTGGGGCCAAGAACAC

AAGAGCGGAGGAAGGGAACAGGTTAAAGAAAACAAGAAACACAATCAGAC

CACAGAAAAGCCAGGCAGAAAAGGGTTCGACGGGCAAAAAGAATGTGGCT

GTCCAGATAAAGAATGTCTGTCCCGGCCCCGGCCTGTGCTGCAAGTGGCA

ACTCACCTAGCCGCCTGCCACCCAGGCTCCCGCCCACCGCGCAGCCCCGC

CAGCGGCTTCTCGCCTCCCCTCTGCCTCGGATAGGGTTAGGGCCTGAGGT

AAATAAATGCAAGGCCTTCAATTCTCCAAGCAGTGCGCAGTGCATTTTTC

TTTATTTCTGGGAACTTGCGCCCAGGTCTCTGTCAGGCCTGCTGTGAGGG

ATTCTACGCGGGGAGAAGGTGGAGGCTGCGCAGGTGGAGAAAGGGGCCCC

AGAAGGGGGGCTAGAAGTGGAGGGCAACGTGGGGGCGGGGCGGGTATCCC

AGAGGGTGCCCCTGGAGGGTCCTGTAGTTGATGTCTTAAACATGCAGGTC

ACTTGTTTCAGAGAAACTTTATTTGCTTCTTAGGCCTCGCTAGGAGCATC

GGCTGTTTCAGGACCTGGAGAAAGGCCCCCAGCTCTACCCTGAGAGGACG

TGCTCCTCCACGCTCCTCCGCAAATGCTGTCCCTCTTCCCCAGCCCAGGG

CCCGGCTCTTCGGTGTGTCTGGGCCATTCCAACCCCCGTCTCCCCACCTC

TCCGCATGGCCCTCGCGCCTTGAGACTGGGCAGGGCAGGCTGATGGAGGG

GCCGGGAGGGGTGGCGGTTGCCCAGGCTAACGTGTCCGTCGGTGGGGGTC

CCCTTGTCTTCGCAGAGGTGTAAGGACAAGTTGAACGCTTTGGCCATCTC

GGTGATGAACCAGTGGCCAGGAGTGAAACTGCGGGTGACCGAGGGCTGGG

ACGAAGATGGCCACCACTCAGAGGAGTCTCTGCACTACGAGGGCCGCGCA

GTGGACATCACCACGTCTGACCGCGACCGCAGCAAGTACGGCATGCTGGC

CCGCCTGGCGGTGGAGGCCGGCTTCGACTGGGTGTACTACGAGTCCAAGG

CACATATCCACTGCTCGGTGAAAGCAGGTAAGCTGGCCCTGGCCCCCCGG

ATCCGACCCAAGGAAGGCCATTGGCGCACCTCGGCTTGATTCAAGAGAAA

AAGAAACCTGGGGGGAGGCTGAGGGCCAGGAGCAGGGTCGCTGGGCGATG

ACTGCGTTTCCGCGGTGGAACCTGCCCTGTGAGGTGCCGGCCCCTCGAAA

TCACCCCTACCTTTGAGGCCACAGAGCCCAAGGTTCTCCATGCCCCGAGA

TGGGGTCCTGTGGCTTCCTGCCCGCTTCTGGAGCCCCCACTGCAGGGGGT

GGGAAAGCGTGACTGGGGGAGGGGCGCTAGGCCCTTCCAGGCGAGGGAAG

ACAGCCCTGCGCGGTTAGCCAGGTCTGGGCGAGCTCCTTCCTCTCGTTTA

GGGCTTAAGAACCAACCGCCCCCACCCGCTATCCCAAGCGCAGGGGTGTC

TATCCTGCCCCGGAGCCCGCGTCCTGGCTCCTCCCCGCCGGGCGCCCGTG

GATCCTAAGCTGCCTTTGGGGAGAGGCCTGGTGGGCGGCAGTAAACCCAG

GGGCAACCACCTCCAGCATCTGGAGGCGGCGCGCCCGGAGCCTGCGTTCC

TACTGGGAGCCGGGCCGGGACGCCCTGGGCGGCGGGCAGGCCCCGAAACG

CCGGCCCGAGTCGGCGCGAGGCTGTCTTCTCTGGGCCTGCAACGCCACAC

GCTGTTGCCGGCGAGGAACAGCCGTGGAGGAGGCGCCATCGCGCGCACGC

AAACCTCCGGCCCGAGGCTGTGTGCACAGCGCTCTTCTCCGCCCGCATAA

ATTGGCACGTTTAGCAAAGCCGTTCACGGTGAATTTCGGGGAAACTCTGC

CTTCCTCAACCCCCTTCCAGGCTTCCCTACTTGTCTCCTAAATTCCATGT

TAATGGCACTATGTTAGTAGGAAAACACTGTTAAGGTGTCAAGGCACACT

TGTAGGTAAAGGCTAGAGTGGCTTCTCGTCCCCACAGAAAGCAAAGGCGT

GGAGCGGGGGCGGCAGGGGCGGGTGTGCGGCCCGGAGAGCTCCCGGCTGC

AGGCAGGCAGGAGGCGGCGCCCCCACCTCGCGGGCTCGGCGGCGGCCCCT

GGGCCCAGGGCGCCCCCTGCGCAAAACCTCCTCCCCGGCTCCCTGCCCGC

GGGGTCCCCCTAGCGGGGGTCTCCGGAGGCCTCCTCCCAAGTGAGCAGCG

CTAATCCATCCCCCGGATCGCGCCGGGAGAGCGGAGCCGCGGCGCGGGAG

CCGCTCATTGGCATTCTGAGCACACGGGCGGGGGCGCGGGGCGCAGCGTG

TCAAGCCGGGCCGTGCGACTCGACGACTCGGGCTCGCCAGCGCCCGGGGT

CGCATTCCGGGGGGCTACGGAGGGCCTCCAACGGCCAGCCCCGCACTTCA

TGCCAGAGAAACCGATGAGAAGATTAAAAGCCCCCTGTAATTCCAGCAGG

AAGATTCTTTCTGGCAATCTCTATTTGCAAAAAGCATGATCCCGGAGATT

GGAATGCAAAGAAGACGGCCCTCCCCGCCCTCCTCCCCGGCCCCCTGCGC

TCCGCCCCAACTTCAATTATTGTCCTGGGGACAGTGAGCCTCAGAGAGCG

ACAGAGGGCTCGAGAAAGCGGGTAGTCAAGGGGCCTTGAGACCCGGCGCT

TCCAGCGCTCCGAACAGGCCCCGCCATTTAAAATTCAAATACACATCTTG

AGTGCTTGGAAGAGAGGCCTGGCTGTGCAAATAGTGCTTGTGAATTGCAC

ACGGGGTGGGGGGGGGTTGCACCTGAGCAAATAGGGAGGGGGAGGCCCGC

GAGCTGGGGAGAGAGTGAGCTGAGAACAGGGAGGGGAGAAAATGGAAGTG

TCCCCTTCCAAGAGTGTCTCCTGTTTATCCCAGAAATCACAATGACAATG

CTGGGCCCTTTATTGGATTTTAATTAGAAAATCCACACAAGCCTCGGATT

TTCACACCTCGGCCAATCTCTGGAATGTTTGTCCAGTTGCTACAACTACT

GCAGCTATTTTTCACTCCCCGCCCCCGCCCCTCCGCAGGCCCACGCCGAG

GCGCGGCAGGGTGCTGCGGGCAGGCGGGCAGGCGGGCAGGCGGGCCAGGG

GTTTCCGCCGCGCAGCCCGGGTGCTGAGTGCGCGAGCAGGCGCCGCGCCC

CGCGCCGGGGCGGGAGGGAAGGAGGGTGCGCCCGGCGCCCGCGGGAGCTC

AAGGAGGCTTCCTGAGGAATCCAAGTGCAGAGCAAACACCCTCTGGATGG

ATTCGCGGCGAGGCCGGGTGTGTGCGGAGCTGGGGGTGGGGTTGGAGGAA

GGCGGAAGGAAAGAGTGTCACCGGCCTCTGCAGGAAACGCCAGCCAACCT

CTGTGACCGCCAGCCCAGACTTAGAGAGTCGTTAAGGAATGTGTCGGAAT

CCTGTCCCTGGGGCAGTGGGGTTGGGGGAGGGAGGTGTGTGCGGGACCCG

CCTGGAATCAATCGCCCCGCCCCGCGCCTTGCGCACCCCTGGCCTAGGAG

CGCGGGCACCAAGCGTGCGCCCTCCTCCCCGAGACGCGCCTCCCTCTCGG

AACTCAATGCCCTGTCCTCTCTTCTTTCCCTTCTCCTCACCCGCAGAGAA

CTCGGTGGCGGCCAAATCGGGAGGCTGCTTCCCGGGCTCGGCCACGGTGC

ACCTGGAGCAGGGCGGCACCAAGCTGGTGAAGGACCTGAGCCCCGGGGAC

CGCGTGCTGGCGGCGGACGACCAGGGCCGGCTGCTCTACAGCGACTTCCT

CACTTTCCTGGACCGCGACGACGGCGCCAAGAAGGTCTTCTACGTGATCG

AGACGCGGGAGCCGCGCGAGCGCCTGCTGCTCACCGCCGCGCACCTGCTC

TTTGTGGCGCCGCACAACGACTCGGCCACCGGGGAGCCCGAGGCGTCCTC

GGGCTCGGGGCCGCCTTCCGGGGGCGCACTGGGGCCTCGGGCGCTGTTCG

CCAGCCGCGTGCGCCCGGGCCAGCGCGTGTACGTGGTGGCCGAGCGTGAC

GGGGACCGCCGGCTCCTGCCCGCCGCTGTGCACAGCGTGACCCTAAGCGA

GGAGGCCGCGGGCGCCTACGCGCCGCTCACGGCCCAGGGCACCATTCTCA

TCAACCGGGTGCTGGCCTCGTGCTACGCGGTCATCGAGGAGCACAGCTGG

GCGCACCGGGCCTTCGCGCCCTTCCGCCTGGCGCACGCGCTCCTGGCTGC

ACTGGCGCCCGCGCGCACGGACCGCGGCGGGGACAGCGGCGGCGGGGACC

GCGGGGGCGGCGGCGGCAGAGTAGCCCTAACCGCTCCAGGTGCTGCCGAC

GCTCCGGGTGCGGGGGCCACCGCGGGCATCCACTGGTACTCGCAGCTGCT

CTACCAAATAGGCACCTGGCTCCTGGACAGCGAGGCCCTGCACCCGCTGG

GCATGGCGGTCAAGTCCAGCTGA  -3′

(HINT:  This gene was named after a video game that was also popular around the time I was 10.)