patron saint of headaches

If only medicine were this simple.

Have a headache?  Say a little prayer and a saint will bring a magical aged rabbit, place it on your head (which will feel extra nice because of its soft rabbit fur), and your headache will get better… probably.

Instead, nowadays, we spend several years and millions of dollars to figure out what causes headache and then even more time and money developing some kind of therapy.

But, to some people, modern medicine is just as mystical as the anti-headache rabbit idea:

Have a headache? Make a little phone call and a doctor will give you a magical pill, that you place in your mouth (which will feel extra nice because of its sweet coating), and your headache will get better… probably.

Just like magic.

the limerick of syphilis

There was a young man of Black Bay,
Who thought syphilis just went away,
And felt that a chancre,
Was merely a canker,
Acquired in lascivious play.

Now first he got acne vulgaris,
The kind that is rampant in Paris,
It covered his skin,
From forehead to shin,
And now people ask where his hair is.

With symptoms increasing in number,
His aorta’s in need of a plumber,
His heart is cavorting,
His wife is aborting,
And now he’s acquired a gumma.

Consider his terrible plight,
His eyes won’t react to the light,
His hands are apraxic
His gait is ataxic,
He’s developing gun-barrell sight.

His passions are strong, as before,
But his penis is flaccid, and sore,
His wife now has tabes
And sabre-shinned babies,
She’s really worse off than a whore.

There are pains in his belly and knees,
His sphincters have gone by degrees,
Paroxysmal incontinence,
With all its concomitants,
Brings on quite unpredictable pees.

Though treated in every known way,
His spirochetes grow day by day,
He’s developed paresis,
Converses with Jesus,
And thinks he’s the Queen of the May.

research ethics a la facebook

I’m taking a research ethics class right now.  It’s required for certain grants, and it actually teaches some very valuable information about how to properly go about research.  It’s still boring, but good nonetheless.  It’s a small class of about 20 people — mostly residents and researchers.

I typically sit towards the back row, and yesterday I noticed something funny.  Of all the people using laptops, at least 4 of them were looking at facebook during the lecture and everybody else was using email or google.  I thought that this was a phenomenon of people my age and younger, not older people who have real jobs.  I was wrong.

I’m guilty of it too, though.  I’ve been known to take a peek into the book of faces during lulls in lectures, but not in this class.  I don’t feel that using a computer is justified in this class as I take scanty notes.  I usually just sit there with a notebook and write one or two sentences per two-hour session.

The interesting thing was that facebook didn’t seem to distract from class participation or discussion.  We still held a lively discussion about what constituted human-subject research, yada yada yada.

So maybe facebook doesn’t get in the way of learning as some people have suggested.  Well, actually, it probably does.  In either case I suppose it’s disrespectful to the instructors, and you shouldn’t do it — very much.

But at least the younger students aren’t putting thumb tacs on teachers’ chairs and pulling other stupid pranks like they used to.  Nowadays a lot of them are just listless, obese, and apathetic.

Not sure which is better.

salty dreams

The other night I had a dream.  Thing is, I don’t remember much of it.  But I do remember waking up with my face drenched in tears.  What was I dreaming about?!

There’s a theory about dreams that could make some sense out of this.  The basic idea is that dreams allow our minds to simulate dangerous situations in the safety of our sleep.  It’s like a kind of virtual reality training ground where our ancestors could learn how to outwit a saber-toothed cat without actually being confronted by a saber-toothed cat.

So what would my brain have been simulating that would make me cry in my sleep?  I’ve had scary dreams before, sometimes involving large bodies of raging water and/or falling off of ladders (interpretation please?).  But this one was different because I didn’t feel scared — I felt sad.

I think I would rather have the scary dreams about avoiding large predators.  But then again, maybe that’s why my brain simulated something sad instead of something action-packed, exciting, and scary.  The fact that I don’t want to experience it makes it more likely that my mind will simulate it.  Maybe?

Is my brain really using some kind of reverse psychology on itself?  Whoa… I think I just blew my mind.

the ardent fans of harry potter

credit: warner brosI’ve only gone to two midnight movie showings in my life.

The first one was the 2001 re-make of The Planet of the Apes.  That was interesting.  My advice to movie makers: never attempt to re-make anything that originally had Charlton Heston in it.  Don’t ask why.

The second one was the recently-released final Harry Potter film.  This one wasn’t that bad actually.  Stuff happened, and there was blood.  That’s the great thing about making a movie or writing a book that is “the conclusion” of a series — every character is expendable.  After a decade of character development, you can finally kill off major characters.

I do chuckle a little bit about it, though.  Since some overly-enamored Harry Potter fans have spent so many years becoming acquainted with these characters, they have formed a strong emotional bond with them.  Some Harry Potter fans have spent more years getting to know the books’ fictitious characters than they have getting to know most of their current real-life friends.

So… I was sitting there munching on popcorn and sipping on soda.  The movie had come to a dramatic moment when some major characters had died while fighting in a magical battle.  Little by little, I became aware of quiet sniffling all around me.  Then the girl sitting to my left gradually began to sob profusely, complete with anxious gasps and moans.  (I would strongly recommend clicking on the words “sobbing profusely” in the previous sentence.)  Perhaps I’m a bit cynical, but I couldn’t help but smile and laugh quietly to myself in the darkness.  Fortunately, nobody could see me, because they most certainly would have been angry with me.

The whole experience was pretty entertaining.  I couldn’t help but laugh a little about how seriously people took this book/movie series.  Here were people, mostly in their mid-twenties, dressed up in ornate costumes of their favorite characters, complete with little magic wants that had lights on the end — how could I not laugh at them a little bit?

And then there was the guy walking around in a storm trooper costume.  Yeah… I don’t know what that was all about either.

DNA!

When I was about ten years old I went to see the movie Jurassic Park.  I loved it!  Cloning dinosaurs?!  Awesome!!

In hindsight, I guess I was kind of a geek.  I thought it was just so cool that they had computer screens full of ‘T’s, ‘A’s, ‘C’s, and ‘G’s.  Their “scientists” could just scroll through the genetic code and use it for whatever they wanted.  Pretty sweet.

I was thinking about this today as I was looking up sequences on the internet and copying large numbers of ‘T’s, ‘A’s, ‘C’s, and ‘G’s on my computer screen.  And in the spirit of geeky genetics fun, here’s a contest.

Name the gene that the following sequence encodes.  (Post your answer in the comments. Hint at the end.)

5′-  ATGCTGCTGCTGGCGAGATGTCTGCTGCTAGTCCTCGTCTCCTCGCTGCT

GGTATGCTCGGGACTGGCGTGCGGACCGGGCAGGGGGTTCGGGAAGAGGA

GGCACCCCAAAAAGCTGACCCCTTTAGCCTACAAGCAGTTTATCCCCAAT

GTGGCCGAGAAGACCCTAGGCGCCAGCGGAAGGTATGAAGGGAAGATCTC

CAGAAACTCCGAGCGATTTAAGGAACTCACCCCCAATTACAACCCCGACA

TCATATTTAAGGATGAAGAAAACACCGGAGCGGACAGGCTGATGACTCAG

GTAGGAACCCAGCGCCGGGGCGTGGAATGTGTGGCTTTCCAGGGGGTTAC

GAGAAGCCGAACACTTCCAGACTTAACTCTGTTTGCTCTTCGGGCAGATA

GGAAGGTGATTTCACCCGCTCCTTCCCCACCCACCTGCCCGCCCCCCATC

TCTTCCTCTTCCTGGAGGAGAATGGAGGTCAAGGGTCCAGCTGGAGAAGT

TTAGGGTGTGGTGGGGGTGAGGACGGTAACAGACGTGGTTCATTATGGCC

CTGATTTGATGAGTCTTGCTACAATGGCCTTCCCCATCCTACCTCTGCCC

TGGCTTGTAACTTGGGGAGACCTTCACTTTGGGGGCGTCGGCCCTTTCCA

AGTCAGGAGTGGAAATGGAAGGAGAGGCTGGGAATCCCCCTCCCACAAAC

ATGAAGTGGTCTCCTGGTACTGTACGAACGAACGAACGTAGCCTTGGGCA

TTGGAGCTCAGAGCCCCCACGTTTCCCGTTGCCTCTGTGGTTTTCTTTCC

CACCACTACCCCCACCCTGCACCTCCCCACCAAAGAATTCTCAACTGGAA

AAGCCAGGAGGCGGTTCTGACAAAAGGCAGGGGCTCCAGGGGAGACTCCG

CCCGTCCCTGGGTGGCTGGCTGTATCGCAGAGCTGGCTTTGCGATTGCGT

GTCCGCAATTGTGCCCATCAGAGTGTGAATGTATTGATATTTCTTTAAGG

ATGCTCTTTCGTTCTTCCAAGCCCGAGGTACCTTAGGGGAGGGACTTAGA

ACTTATTGGCATTGCATCACTTTAGTTTTCAACCTGCTTGCATAAGAATT

AAGAGCGAATAAATATTAGTGTGGGGGGAGGGGAAGCTAAGCAAAATATG

AATTCCTCTCTCTCTCCCCACCTCCTTTGAGATTTCTGAGCTGCCAATCT

CCCAGCCAATTCTAGACTTTCTGAAACTCCATGCACGTATAACTGAAGCC

AGAAATGGGTTTCCTTGCAAATATAGGTCAACATCCTTTTTATTGCCCTA

TTAAAATATTCAAGTCCTACCTTTAGGGCTAGGTGCGTACAGCGGCTGAT

GGAGTGGCGCTGGTGGGGCGCAAGTGCAGGGGGAGGGTACTGACGGCAGA

GAGAGAGGAGCTACCTCCGTGCCGCCCTGCTTCCCGACCCGATTCCCAGG

CTTGCTTGAGGCCGAGAAAGGCGAGGGGCAGGCAAGGTAGCCTGCTCCAG

CTGTCGGAAGGGAGAGGAATGGGAAATGGTCCTGATTTCCTTGCTCTCCC

TCATCTGCTCCCGACCACCTTAAATCTGGACCGCGAGTGTGGACGCGCGC

GCCAGTGCCAGACAGCAGCGCGATCCACAATTAACTCTGCACGGGCCATG

GGGTGCCCGTTGCGTGCAGCTGGCTGGAGGGAGTTCTCCGGCTAGCCCGA

GGCGCCCATCCTCTCGTCACCCTCACTCCCCGCGGAGGAGGGGCCTTGCC

AGGGTCCCTCGGAACCCGAGAGGAGGGAGGCACTGCGGAGAGAGCGGCGG

GGGCGTGGATACCCGAGGTCCCAGAGCCAGAGTGGGTCAGCTTCTGCCCT

GCTCTGCGGGAGGCCAATACCGCAGAAGGGGTCCTGGGCTCGCACACCTT

CCCAGGGCTTGGGCCTTGCAGCCCTGCTGCAAAGCTGCAAGCGCACAGAG

CCGCGCAGCGAGGCAGACGCCTGCAGCCCCACTTACTCCCGGGTTATCGA

TCCCCCGCGGCTAGGGTTTCAGTGCGCGAGGGGCTGGGCTGGAGCCGCCG

GGCTCTGCTGCTCCACGCGCGGGAGCGCAGGCACCGCAGGAGCTAACAGC

AGCGCCGGGCTCGCTGTAGTGTCCCCGGCGGCGGGGGCGCGGAGATGGGG

GCGCCCGCGCAGGGGCCGGGGCGCATCGCGGGCTCCGCCGGCCTGCCCTG

GGACGCGCCCCCATCCCCAGTCCGCCGCCTGCCTGGCCTCTAGGCCTCCG

CGTCCCAGCCGGAGCCCCCAGCCCGGGGGCCTCCCCCCGACCCCCGTCCG

CCCTGCCGGGGGACGCAGGGCCCAGCGGCCCCGCGCCCGGCCACTCTCGC

CGCCGCGCGCACAGGCAGCATTTGAACTTCTGACCTTCTGTCAACTTCCC

TCAGACGAACGAAACGAAAACAAATACTTTTTTCCTTGGGCAGTGGCTAT

TCCCGTTCCCAACACAAAAGGAGGGGGAAGGACGGCCCAAGTGGGGGTTG

GGTGAGGAGAGCCAGGCCGGGATTATCAGGCAGACCCCACAAAGGTCCCC

TAAAACCGAGGGGGGTAGGGGCTGGCAGTCTGTGAGGTATCCCCGGTTGA

TCCCTCCCCTACCTTCCTTCTCCCGATTCCAGGAGTTAAGGGTGGGGGAG

GAAGGGATGGGGAAGGCGGAGGCTCGGGTGCTGAGGGCAGGGGCGGGGTG

CAGGAGGCGGCAGGGGAGCCCCAGGCCGGCGGGAGGTTTGGGGAGCCTGC

TCGGCCGCCCTCATTTTAAATAACCACCTAGGCTCTGCCCCAGGTGCGTG

ACCCTCTTCTTCTGTCTCCCTCCCTGTCTCTGGGTCTCTAATGTGACTGC

CGCCCAAGTCCCTCAACCATGGCGAGATCGTCCCCAGTGGAACTTTCGGA

GCAGTTCCGGAACGCAGGAGCTGCCGGTTAATATTAACCCGGGAGAGGAA

AGCGCAGACAGACACGCTCTCCCCGCGCGGGCCTAGGTGCCAGGCGAGGG

TGCTGGCGGCCAGGGGGCTCCTAAGGGGCAGGAGGCCAGAGGGCCGGATC

TGAAGCCTGGAGTGGGGTCCCGAGCCGCTACACTAAATAGATTTAATGTG

CGCTCTGGGGCCGCCAGGAAAGACGCTCAGGTATGGGGTTGGGGAGGGGC

TGTTCCACCAAGCTTGGGGGAAAGGACAGTGGAGAGAGGTGCGTTTAGGG

GCTGGGGCTGTCTTGAAGCTGGGACGCCCCCGCCCCCGCGCTGGGGGAAG

CCCACCGGCTGCTGGCGGTGACACTCGCCGGCGCGGCTCGCAGATCAGGG

AGGTAGGCGGGAGCTCAGGCGTGGGGAACAACTTGGCCTCCGCCGACACA

AAGCCCGGCCCCGGCGGCCCTGCTGGGCTTCACGGTGGCTGCACAGAGTC

GGGCTTGATTCGCGGCACACGACCCAATGAATTAATAACCGGCCTGGGCT

TCCCGGCTTTGCCTGCGACAATCCCGCCCAGCGCGGGCGGAGGAGAGGCC

GCCAGCCGAGGCCGCGCGGAGCCCGGGCCGGAGGAGGGCGCAAGGGGCGG

GGGCGCCAACTCCAGCAACCCTCGGCCTCCGCCCCTCACTCGCGCAGCCA

CCTCCCGTCGCGGCCCGGCTGGACCCGGGTCTCCCTGCCCGGGGTCCTCC

ATGCCTGCCCAAGTGGCGCAGCTCACAGAGCTGGGGGCCAGGTCATCCTC

ACCCTGCCGCCCTCTCCCTGGCTGCCCTCCTGGGAAGCTGTTTAAAGCTT

CTTCGGCACAGCCCCAGGGGAGGGAGCTGCGGTGGGGTGGGGGGCTTGCA

TGGGGGTCCCTGTGCGTGTTGGTGGTGTGCGCCTGCGCGCAACGGGCCTC

ACATCATAGCTCTACACTGACCCTGGTTTACTGATTGATTTTCATGTAAA

ACGCGTTCAATCCTCAAGATGACCTCACTCAAACTCTGCCCTTCCGACTT

TTTTTTTTAACTGCTGGCAGGCCCACAAACATGCAGGCACTGACCTGTTA

CCAGGGCGGCCCCCAGCCCTACCCCACCCCCAGTTGTTGCATGTTGAACT

CTACAACCATATTACTGGGTTTTATTGCTGCCAGATACACAGGACTTTTC

CTGTTGCGCAATTTGTCACGTCCCCTTAAAGCGCCGCAGCAGTGGGGCCA

GCGTCCTCGCCCCACCCTCTCGAAAGAGTCCCCCCAACCCACGCTACAGT

TAGGGCCCTGGATAGAAGCTGTCCCTCCATGGCGACAACCAGACTCCAAG

CAGAGCATCCTTCCAGACTGGAGGAGGTTAGAGGTCAGCCCCGCCCTCTG

CAGAAGTCACCTTGAAATTGCCCCTCGGCCTCCACTTGGCGCAGCTTCTT

GGGGGATGCCACCATCGTCATCTGTGCCAGTTCCCCCTCTTTAAATCCCA

TGTCCCACCAGCAGCAGCAGGGTAAACATCCAGGAAGCAAGTCAGTGCCC

CCACAAACACACACAGTGGATTCAACTGCTTTCTGTCGCATCCTTATCTG

AGGGTGACCCCAGAATTCCAGGGGAACCCCCACAATCTGAATCCCAGGTA

ACCCCGTCTGCATCTGCCTAGTCAGTGTTTCCTGCCTCCTCCCAGGCAAC

TTCCTGGGAAACTCCCCAGGCGGAGGACTCCGAGACCTCAGGCCTTCCTG

TCTCCCCTCCCCCTCCTCTCAAACCCCTCCCCCTCCCTCCACCTCTTCAG

TTTGCTCTTCAAACTTGCTGGACGCCATTCTATGCTGGGGCCAAGAACAC

AAGAGCGGAGGAAGGGAACAGGTTAAAGAAAACAAGAAACACAATCAGAC

CACAGAAAAGCCAGGCAGAAAAGGGTTCGACGGGCAAAAAGAATGTGGCT

GTCCAGATAAAGAATGTCTGTCCCGGCCCCGGCCTGTGCTGCAAGTGGCA

ACTCACCTAGCCGCCTGCCACCCAGGCTCCCGCCCACCGCGCAGCCCCGC

CAGCGGCTTCTCGCCTCCCCTCTGCCTCGGATAGGGTTAGGGCCTGAGGT

AAATAAATGCAAGGCCTTCAATTCTCCAAGCAGTGCGCAGTGCATTTTTC

TTTATTTCTGGGAACTTGCGCCCAGGTCTCTGTCAGGCCTGCTGTGAGGG

ATTCTACGCGGGGAGAAGGTGGAGGCTGCGCAGGTGGAGAAAGGGGCCCC

AGAAGGGGGGCTAGAAGTGGAGGGCAACGTGGGGGCGGGGCGGGTATCCC

AGAGGGTGCCCCTGGAGGGTCCTGTAGTTGATGTCTTAAACATGCAGGTC

ACTTGTTTCAGAGAAACTTTATTTGCTTCTTAGGCCTCGCTAGGAGCATC

GGCTGTTTCAGGACCTGGAGAAAGGCCCCCAGCTCTACCCTGAGAGGACG

TGCTCCTCCACGCTCCTCCGCAAATGCTGTCCCTCTTCCCCAGCCCAGGG

CCCGGCTCTTCGGTGTGTCTGGGCCATTCCAACCCCCGTCTCCCCACCTC

TCCGCATGGCCCTCGCGCCTTGAGACTGGGCAGGGCAGGCTGATGGAGGG

GCCGGGAGGGGTGGCGGTTGCCCAGGCTAACGTGTCCGTCGGTGGGGGTC

CCCTTGTCTTCGCAGAGGTGTAAGGACAAGTTGAACGCTTTGGCCATCTC

GGTGATGAACCAGTGGCCAGGAGTGAAACTGCGGGTGACCGAGGGCTGGG

ACGAAGATGGCCACCACTCAGAGGAGTCTCTGCACTACGAGGGCCGCGCA

GTGGACATCACCACGTCTGACCGCGACCGCAGCAAGTACGGCATGCTGGC

CCGCCTGGCGGTGGAGGCCGGCTTCGACTGGGTGTACTACGAGTCCAAGG

CACATATCCACTGCTCGGTGAAAGCAGGTAAGCTGGCCCTGGCCCCCCGG

ATCCGACCCAAGGAAGGCCATTGGCGCACCTCGGCTTGATTCAAGAGAAA

AAGAAACCTGGGGGGAGGCTGAGGGCCAGGAGCAGGGTCGCTGGGCGATG

ACTGCGTTTCCGCGGTGGAACCTGCCCTGTGAGGTGCCGGCCCCTCGAAA

TCACCCCTACCTTTGAGGCCACAGAGCCCAAGGTTCTCCATGCCCCGAGA

TGGGGTCCTGTGGCTTCCTGCCCGCTTCTGGAGCCCCCACTGCAGGGGGT

GGGAAAGCGTGACTGGGGGAGGGGCGCTAGGCCCTTCCAGGCGAGGGAAG

ACAGCCCTGCGCGGTTAGCCAGGTCTGGGCGAGCTCCTTCCTCTCGTTTA

GGGCTTAAGAACCAACCGCCCCCACCCGCTATCCCAAGCGCAGGGGTGTC

TATCCTGCCCCGGAGCCCGCGTCCTGGCTCCTCCCCGCCGGGCGCCCGTG

GATCCTAAGCTGCCTTTGGGGAGAGGCCTGGTGGGCGGCAGTAAACCCAG

GGGCAACCACCTCCAGCATCTGGAGGCGGCGCGCCCGGAGCCTGCGTTCC

TACTGGGAGCCGGGCCGGGACGCCCTGGGCGGCGGGCAGGCCCCGAAACG

CCGGCCCGAGTCGGCGCGAGGCTGTCTTCTCTGGGCCTGCAACGCCACAC

GCTGTTGCCGGCGAGGAACAGCCGTGGAGGAGGCGCCATCGCGCGCACGC

AAACCTCCGGCCCGAGGCTGTGTGCACAGCGCTCTTCTCCGCCCGCATAA

ATTGGCACGTTTAGCAAAGCCGTTCACGGTGAATTTCGGGGAAACTCTGC

CTTCCTCAACCCCCTTCCAGGCTTCCCTACTTGTCTCCTAAATTCCATGT

TAATGGCACTATGTTAGTAGGAAAACACTGTTAAGGTGTCAAGGCACACT

TGTAGGTAAAGGCTAGAGTGGCTTCTCGTCCCCACAGAAAGCAAAGGCGT

GGAGCGGGGGCGGCAGGGGCGGGTGTGCGGCCCGGAGAGCTCCCGGCTGC

AGGCAGGCAGGAGGCGGCGCCCCCACCTCGCGGGCTCGGCGGCGGCCCCT

GGGCCCAGGGCGCCCCCTGCGCAAAACCTCCTCCCCGGCTCCCTGCCCGC

GGGGTCCCCCTAGCGGGGGTCTCCGGAGGCCTCCTCCCAAGTGAGCAGCG

CTAATCCATCCCCCGGATCGCGCCGGGAGAGCGGAGCCGCGGCGCGGGAG

CCGCTCATTGGCATTCTGAGCACACGGGCGGGGGCGCGGGGCGCAGCGTG

TCAAGCCGGGCCGTGCGACTCGACGACTCGGGCTCGCCAGCGCCCGGGGT

CGCATTCCGGGGGGCTACGGAGGGCCTCCAACGGCCAGCCCCGCACTTCA

TGCCAGAGAAACCGATGAGAAGATTAAAAGCCCCCTGTAATTCCAGCAGG

AAGATTCTTTCTGGCAATCTCTATTTGCAAAAAGCATGATCCCGGAGATT

GGAATGCAAAGAAGACGGCCCTCCCCGCCCTCCTCCCCGGCCCCCTGCGC

TCCGCCCCAACTTCAATTATTGTCCTGGGGACAGTGAGCCTCAGAGAGCG

ACAGAGGGCTCGAGAAAGCGGGTAGTCAAGGGGCCTTGAGACCCGGCGCT

TCCAGCGCTCCGAACAGGCCCCGCCATTTAAAATTCAAATACACATCTTG

AGTGCTTGGAAGAGAGGCCTGGCTGTGCAAATAGTGCTTGTGAATTGCAC

ACGGGGTGGGGGGGGGTTGCACCTGAGCAAATAGGGAGGGGGAGGCCCGC

GAGCTGGGGAGAGAGTGAGCTGAGAACAGGGAGGGGAGAAAATGGAAGTG

TCCCCTTCCAAGAGTGTCTCCTGTTTATCCCAGAAATCACAATGACAATG

CTGGGCCCTTTATTGGATTTTAATTAGAAAATCCACACAAGCCTCGGATT

TTCACACCTCGGCCAATCTCTGGAATGTTTGTCCAGTTGCTACAACTACT

GCAGCTATTTTTCACTCCCCGCCCCCGCCCCTCCGCAGGCCCACGCCGAG

GCGCGGCAGGGTGCTGCGGGCAGGCGGGCAGGCGGGCAGGCGGGCCAGGG

GTTTCCGCCGCGCAGCCCGGGTGCTGAGTGCGCGAGCAGGCGCCGCGCCC

CGCGCCGGGGCGGGAGGGAAGGAGGGTGCGCCCGGCGCCCGCGGGAGCTC

AAGGAGGCTTCCTGAGGAATCCAAGTGCAGAGCAAACACCCTCTGGATGG

ATTCGCGGCGAGGCCGGGTGTGTGCGGAGCTGGGGGTGGGGTTGGAGGAA

GGCGGAAGGAAAGAGTGTCACCGGCCTCTGCAGGAAACGCCAGCCAACCT

CTGTGACCGCCAGCCCAGACTTAGAGAGTCGTTAAGGAATGTGTCGGAAT

CCTGTCCCTGGGGCAGTGGGGTTGGGGGAGGGAGGTGTGTGCGGGACCCG

CCTGGAATCAATCGCCCCGCCCCGCGCCTTGCGCACCCCTGGCCTAGGAG

CGCGGGCACCAAGCGTGCGCCCTCCTCCCCGAGACGCGCCTCCCTCTCGG

AACTCAATGCCCTGTCCTCTCTTCTTTCCCTTCTCCTCACCCGCAGAGAA

CTCGGTGGCGGCCAAATCGGGAGGCTGCTTCCCGGGCTCGGCCACGGTGC

ACCTGGAGCAGGGCGGCACCAAGCTGGTGAAGGACCTGAGCCCCGGGGAC

CGCGTGCTGGCGGCGGACGACCAGGGCCGGCTGCTCTACAGCGACTTCCT

CACTTTCCTGGACCGCGACGACGGCGCCAAGAAGGTCTTCTACGTGATCG

AGACGCGGGAGCCGCGCGAGCGCCTGCTGCTCACCGCCGCGCACCTGCTC

TTTGTGGCGCCGCACAACGACTCGGCCACCGGGGAGCCCGAGGCGTCCTC

GGGCTCGGGGCCGCCTTCCGGGGGCGCACTGGGGCCTCGGGCGCTGTTCG

CCAGCCGCGTGCGCCCGGGCCAGCGCGTGTACGTGGTGGCCGAGCGTGAC

GGGGACCGCCGGCTCCTGCCCGCCGCTGTGCACAGCGTGACCCTAAGCGA

GGAGGCCGCGGGCGCCTACGCGCCGCTCACGGCCCAGGGCACCATTCTCA

TCAACCGGGTGCTGGCCTCGTGCTACGCGGTCATCGAGGAGCACAGCTGG

GCGCACCGGGCCTTCGCGCCCTTCCGCCTGGCGCACGCGCTCCTGGCTGC

ACTGGCGCCCGCGCGCACGGACCGCGGCGGGGACAGCGGCGGCGGGGACC

GCGGGGGCGGCGGCGGCAGAGTAGCCCTAACCGCTCCAGGTGCTGCCGAC

GCTCCGGGTGCGGGGGCCACCGCGGGCATCCACTGGTACTCGCAGCTGCT

CTACCAAATAGGCACCTGGCTCCTGGACAGCGAGGCCCTGCACCCGCTGG

GCATGGCGGTCAAGTCCAGCTGA  -3′

(HINT:  This gene was named after a video game that was also popular around the time I was 10.)

toilet pager

Do you wear a pager?  Ever noticed how when you go to the bathroom the pager just seems to be laser guided directly into the toilet?  Seriously!

You undo your belt and start to move things in the desired direction, and the next thing you know… KerPlunk!!!  You swing around and to your horror the weight of the pager has forced your belt to come out of the belt loops, and the pager has flown directly into the dirty waters.  (Hopefully the waters aren’t too dirty yet…  anyway…)

Next comes the terrifying moment of reckoning.  You stare at it sitting there on the bottom of the porcelain sea, tiny bubbles streaming out of it, and you think to yourself:

“Do I grab it, or should I try and get a stick or something?  If I wait too long it’ll be ruined.  Maybe if I grab it fast I can save it.  Yup… gotta grab it.  I can scrub my hands after.  Okay.  Ready.  GO!”

So you reach in and you grab the pager.  It’s a little surprising how much it splashes – you must have grabbed it more quickly than you thought.  And now you’re standing there, pants around your ankles, looking at yourself in the mirror, holding a soaking wet toilet pager in your hand.

You look at it.  The screen is dead.  Crap!  You grab a towel and wipe it off, shake out some of the water that got inside, and towel it off again.  Oh!  Take out the battery!  That might help.  It’s probably still okay.  It’s just got to dry out.  Right?

Now what?  Oh yeah!  Wash your hands!!  Now quick, pull up your pants and go google “toilet pager”!  With the towel-covered pager in hand you move with purpose to the computer.  To your surprise (or not) there’s actually a large amount of information on the subject.

RICE!  That’s the answer!  Bury the pager in a bowl of uncooked rice and wait for like 2 days.  Okay… you have a plan… everything’s going to be all right… take a breath.

Now… back to the bathroom to finish the business that you had initially set out to take care of.  …Maybe leave the cell phone behind.