fatigued

The most recent rephrasing of the term “burnout” is “compassion fatigue”.  At least that’s what they’re calling it among medical professionals.  But I don’t think that’s exactly what I’m feeling.  In fact, I’m certain that it’s not, because I haven’t interacted with very many patients yet.  No, I’m just fatigued.  Compassion has nothing to do with it.

I feel like I could, right now, quit school and be adequately satisfied.  I just finished my second year of medical school and now I’m off to PhD-land to work for the next 4 to 5 years. Before starting in the lab, though, I have the USMLE Step 1 exam.  This is likely one of the most important exams of my life and I should be preparing more than I am, but I feel kind of numb to the urgency.  It’s as if I’ve accepted that a small improvement in my test score isn’t worth the quantity and rigor of the effort required.

I’ve kind of checked out.  And my feelings are even further complicated by my final exam scores that I just received today.  I passed, which is all that matters in the end.  But my score was substantially lower than what I had expected.  This is more of an ego bruise than anything.  I felt like I had done reasonably well.  Getting a low score puts questions into my mind about whether I really know what I’m doing.  (But if you ask any seasoned physician they’d say that no second year really knows what she/he is doing yet.  Somehow that’s not comforting.)  It shook my confidence.  But despite the sting, this is probably good for me.  The last thing this world needs is more overconfident medical students.

Back to PhD-land…

I have a meeting this afternoon with my new mentor.  He’s a strong scientist, an MD/PhD grad, and a nice guy.  But I’m nervous that I have little to discuss with him.  I’ve set up email alerts for papers in certain subjects, but so far that’s as far as I’ve gone.  I haven’t really read any of the papers.  I have ideas, but they’re very broad.  None of them are appropriate thesis ideas.

Since I’m just venting, and this is terribly uninteresting to read, I’ll get to some point…

Bottom line:  I’m stuck in a difficult place right now.  The path of my classmates and friends is diverging from my path.  I’m uncomfortable with mediocrity (even when it’s adequate), but I lack the time, energy, and will to achieve anything more than the minimum required right now.  I guess that’s kind of what burnout is.  My passion for this stuff has faded from a bright flame to a tiny glowing ember.  I really need to find some gas to pour on and start up the fire again.  Tricky part is… if I throw too much on too fast it smothers the ember.  What I need is not too much, not too little, but juuuuuust enough.

That’s another phrase I’ve heard thrown around lately: the “Goldilocks effect”.  My, aren’t we clever.  (forgive the sarcasm)

Advertisements

DNA!

When I was about ten years old I went to see the movie Jurassic Park.  I loved it!  Cloning dinosaurs?!  Awesome!!

In hindsight, I guess I was kind of a geek.  I thought it was just so cool that they had computer screens full of ‘T’s, ‘A’s, ‘C’s, and ‘G’s.  Their “scientists” could just scroll through the genetic code and use it for whatever they wanted.  Pretty sweet.

I was thinking about this today as I was looking up sequences on the internet and copying large numbers of ‘T’s, ‘A’s, ‘C’s, and ‘G’s on my computer screen.  And in the spirit of geeky genetics fun, here’s a contest.

Name the gene that the following sequence encodes.  (Post your answer in the comments. Hint at the end.)

5′-  ATGCTGCTGCTGGCGAGATGTCTGCTGCTAGTCCTCGTCTCCTCGCTGCT

GGTATGCTCGGGACTGGCGTGCGGACCGGGCAGGGGGTTCGGGAAGAGGA

GGCACCCCAAAAAGCTGACCCCTTTAGCCTACAAGCAGTTTATCCCCAAT

GTGGCCGAGAAGACCCTAGGCGCCAGCGGAAGGTATGAAGGGAAGATCTC

CAGAAACTCCGAGCGATTTAAGGAACTCACCCCCAATTACAACCCCGACA

TCATATTTAAGGATGAAGAAAACACCGGAGCGGACAGGCTGATGACTCAG

GTAGGAACCCAGCGCCGGGGCGTGGAATGTGTGGCTTTCCAGGGGGTTAC

GAGAAGCCGAACACTTCCAGACTTAACTCTGTTTGCTCTTCGGGCAGATA

GGAAGGTGATTTCACCCGCTCCTTCCCCACCCACCTGCCCGCCCCCCATC

TCTTCCTCTTCCTGGAGGAGAATGGAGGTCAAGGGTCCAGCTGGAGAAGT

TTAGGGTGTGGTGGGGGTGAGGACGGTAACAGACGTGGTTCATTATGGCC

CTGATTTGATGAGTCTTGCTACAATGGCCTTCCCCATCCTACCTCTGCCC

TGGCTTGTAACTTGGGGAGACCTTCACTTTGGGGGCGTCGGCCCTTTCCA

AGTCAGGAGTGGAAATGGAAGGAGAGGCTGGGAATCCCCCTCCCACAAAC

ATGAAGTGGTCTCCTGGTACTGTACGAACGAACGAACGTAGCCTTGGGCA

TTGGAGCTCAGAGCCCCCACGTTTCCCGTTGCCTCTGTGGTTTTCTTTCC

CACCACTACCCCCACCCTGCACCTCCCCACCAAAGAATTCTCAACTGGAA

AAGCCAGGAGGCGGTTCTGACAAAAGGCAGGGGCTCCAGGGGAGACTCCG

CCCGTCCCTGGGTGGCTGGCTGTATCGCAGAGCTGGCTTTGCGATTGCGT

GTCCGCAATTGTGCCCATCAGAGTGTGAATGTATTGATATTTCTTTAAGG

ATGCTCTTTCGTTCTTCCAAGCCCGAGGTACCTTAGGGGAGGGACTTAGA

ACTTATTGGCATTGCATCACTTTAGTTTTCAACCTGCTTGCATAAGAATT

AAGAGCGAATAAATATTAGTGTGGGGGGAGGGGAAGCTAAGCAAAATATG

AATTCCTCTCTCTCTCCCCACCTCCTTTGAGATTTCTGAGCTGCCAATCT

CCCAGCCAATTCTAGACTTTCTGAAACTCCATGCACGTATAACTGAAGCC

AGAAATGGGTTTCCTTGCAAATATAGGTCAACATCCTTTTTATTGCCCTA

TTAAAATATTCAAGTCCTACCTTTAGGGCTAGGTGCGTACAGCGGCTGAT

GGAGTGGCGCTGGTGGGGCGCAAGTGCAGGGGGAGGGTACTGACGGCAGA

GAGAGAGGAGCTACCTCCGTGCCGCCCTGCTTCCCGACCCGATTCCCAGG

CTTGCTTGAGGCCGAGAAAGGCGAGGGGCAGGCAAGGTAGCCTGCTCCAG

CTGTCGGAAGGGAGAGGAATGGGAAATGGTCCTGATTTCCTTGCTCTCCC

TCATCTGCTCCCGACCACCTTAAATCTGGACCGCGAGTGTGGACGCGCGC

GCCAGTGCCAGACAGCAGCGCGATCCACAATTAACTCTGCACGGGCCATG

GGGTGCCCGTTGCGTGCAGCTGGCTGGAGGGAGTTCTCCGGCTAGCCCGA

GGCGCCCATCCTCTCGTCACCCTCACTCCCCGCGGAGGAGGGGCCTTGCC

AGGGTCCCTCGGAACCCGAGAGGAGGGAGGCACTGCGGAGAGAGCGGCGG

GGGCGTGGATACCCGAGGTCCCAGAGCCAGAGTGGGTCAGCTTCTGCCCT

GCTCTGCGGGAGGCCAATACCGCAGAAGGGGTCCTGGGCTCGCACACCTT

CCCAGGGCTTGGGCCTTGCAGCCCTGCTGCAAAGCTGCAAGCGCACAGAG

CCGCGCAGCGAGGCAGACGCCTGCAGCCCCACTTACTCCCGGGTTATCGA

TCCCCCGCGGCTAGGGTTTCAGTGCGCGAGGGGCTGGGCTGGAGCCGCCG

GGCTCTGCTGCTCCACGCGCGGGAGCGCAGGCACCGCAGGAGCTAACAGC

AGCGCCGGGCTCGCTGTAGTGTCCCCGGCGGCGGGGGCGCGGAGATGGGG

GCGCCCGCGCAGGGGCCGGGGCGCATCGCGGGCTCCGCCGGCCTGCCCTG

GGACGCGCCCCCATCCCCAGTCCGCCGCCTGCCTGGCCTCTAGGCCTCCG

CGTCCCAGCCGGAGCCCCCAGCCCGGGGGCCTCCCCCCGACCCCCGTCCG

CCCTGCCGGGGGACGCAGGGCCCAGCGGCCCCGCGCCCGGCCACTCTCGC

CGCCGCGCGCACAGGCAGCATTTGAACTTCTGACCTTCTGTCAACTTCCC

TCAGACGAACGAAACGAAAACAAATACTTTTTTCCTTGGGCAGTGGCTAT

TCCCGTTCCCAACACAAAAGGAGGGGGAAGGACGGCCCAAGTGGGGGTTG

GGTGAGGAGAGCCAGGCCGGGATTATCAGGCAGACCCCACAAAGGTCCCC

TAAAACCGAGGGGGGTAGGGGCTGGCAGTCTGTGAGGTATCCCCGGTTGA

TCCCTCCCCTACCTTCCTTCTCCCGATTCCAGGAGTTAAGGGTGGGGGAG

GAAGGGATGGGGAAGGCGGAGGCTCGGGTGCTGAGGGCAGGGGCGGGGTG

CAGGAGGCGGCAGGGGAGCCCCAGGCCGGCGGGAGGTTTGGGGAGCCTGC

TCGGCCGCCCTCATTTTAAATAACCACCTAGGCTCTGCCCCAGGTGCGTG

ACCCTCTTCTTCTGTCTCCCTCCCTGTCTCTGGGTCTCTAATGTGACTGC

CGCCCAAGTCCCTCAACCATGGCGAGATCGTCCCCAGTGGAACTTTCGGA

GCAGTTCCGGAACGCAGGAGCTGCCGGTTAATATTAACCCGGGAGAGGAA

AGCGCAGACAGACACGCTCTCCCCGCGCGGGCCTAGGTGCCAGGCGAGGG

TGCTGGCGGCCAGGGGGCTCCTAAGGGGCAGGAGGCCAGAGGGCCGGATC

TGAAGCCTGGAGTGGGGTCCCGAGCCGCTACACTAAATAGATTTAATGTG

CGCTCTGGGGCCGCCAGGAAAGACGCTCAGGTATGGGGTTGGGGAGGGGC

TGTTCCACCAAGCTTGGGGGAAAGGACAGTGGAGAGAGGTGCGTTTAGGG

GCTGGGGCTGTCTTGAAGCTGGGACGCCCCCGCCCCCGCGCTGGGGGAAG

CCCACCGGCTGCTGGCGGTGACACTCGCCGGCGCGGCTCGCAGATCAGGG

AGGTAGGCGGGAGCTCAGGCGTGGGGAACAACTTGGCCTCCGCCGACACA

AAGCCCGGCCCCGGCGGCCCTGCTGGGCTTCACGGTGGCTGCACAGAGTC

GGGCTTGATTCGCGGCACACGACCCAATGAATTAATAACCGGCCTGGGCT

TCCCGGCTTTGCCTGCGACAATCCCGCCCAGCGCGGGCGGAGGAGAGGCC

GCCAGCCGAGGCCGCGCGGAGCCCGGGCCGGAGGAGGGCGCAAGGGGCGG

GGGCGCCAACTCCAGCAACCCTCGGCCTCCGCCCCTCACTCGCGCAGCCA

CCTCCCGTCGCGGCCCGGCTGGACCCGGGTCTCCCTGCCCGGGGTCCTCC

ATGCCTGCCCAAGTGGCGCAGCTCACAGAGCTGGGGGCCAGGTCATCCTC

ACCCTGCCGCCCTCTCCCTGGCTGCCCTCCTGGGAAGCTGTTTAAAGCTT

CTTCGGCACAGCCCCAGGGGAGGGAGCTGCGGTGGGGTGGGGGGCTTGCA

TGGGGGTCCCTGTGCGTGTTGGTGGTGTGCGCCTGCGCGCAACGGGCCTC

ACATCATAGCTCTACACTGACCCTGGTTTACTGATTGATTTTCATGTAAA

ACGCGTTCAATCCTCAAGATGACCTCACTCAAACTCTGCCCTTCCGACTT

TTTTTTTTAACTGCTGGCAGGCCCACAAACATGCAGGCACTGACCTGTTA

CCAGGGCGGCCCCCAGCCCTACCCCACCCCCAGTTGTTGCATGTTGAACT

CTACAACCATATTACTGGGTTTTATTGCTGCCAGATACACAGGACTTTTC

CTGTTGCGCAATTTGTCACGTCCCCTTAAAGCGCCGCAGCAGTGGGGCCA

GCGTCCTCGCCCCACCCTCTCGAAAGAGTCCCCCCAACCCACGCTACAGT

TAGGGCCCTGGATAGAAGCTGTCCCTCCATGGCGACAACCAGACTCCAAG

CAGAGCATCCTTCCAGACTGGAGGAGGTTAGAGGTCAGCCCCGCCCTCTG

CAGAAGTCACCTTGAAATTGCCCCTCGGCCTCCACTTGGCGCAGCTTCTT

GGGGGATGCCACCATCGTCATCTGTGCCAGTTCCCCCTCTTTAAATCCCA

TGTCCCACCAGCAGCAGCAGGGTAAACATCCAGGAAGCAAGTCAGTGCCC

CCACAAACACACACAGTGGATTCAACTGCTTTCTGTCGCATCCTTATCTG

AGGGTGACCCCAGAATTCCAGGGGAACCCCCACAATCTGAATCCCAGGTA

ACCCCGTCTGCATCTGCCTAGTCAGTGTTTCCTGCCTCCTCCCAGGCAAC

TTCCTGGGAAACTCCCCAGGCGGAGGACTCCGAGACCTCAGGCCTTCCTG

TCTCCCCTCCCCCTCCTCTCAAACCCCTCCCCCTCCCTCCACCTCTTCAG

TTTGCTCTTCAAACTTGCTGGACGCCATTCTATGCTGGGGCCAAGAACAC

AAGAGCGGAGGAAGGGAACAGGTTAAAGAAAACAAGAAACACAATCAGAC

CACAGAAAAGCCAGGCAGAAAAGGGTTCGACGGGCAAAAAGAATGTGGCT

GTCCAGATAAAGAATGTCTGTCCCGGCCCCGGCCTGTGCTGCAAGTGGCA

ACTCACCTAGCCGCCTGCCACCCAGGCTCCCGCCCACCGCGCAGCCCCGC

CAGCGGCTTCTCGCCTCCCCTCTGCCTCGGATAGGGTTAGGGCCTGAGGT

AAATAAATGCAAGGCCTTCAATTCTCCAAGCAGTGCGCAGTGCATTTTTC

TTTATTTCTGGGAACTTGCGCCCAGGTCTCTGTCAGGCCTGCTGTGAGGG

ATTCTACGCGGGGAGAAGGTGGAGGCTGCGCAGGTGGAGAAAGGGGCCCC

AGAAGGGGGGCTAGAAGTGGAGGGCAACGTGGGGGCGGGGCGGGTATCCC

AGAGGGTGCCCCTGGAGGGTCCTGTAGTTGATGTCTTAAACATGCAGGTC

ACTTGTTTCAGAGAAACTTTATTTGCTTCTTAGGCCTCGCTAGGAGCATC

GGCTGTTTCAGGACCTGGAGAAAGGCCCCCAGCTCTACCCTGAGAGGACG

TGCTCCTCCACGCTCCTCCGCAAATGCTGTCCCTCTTCCCCAGCCCAGGG

CCCGGCTCTTCGGTGTGTCTGGGCCATTCCAACCCCCGTCTCCCCACCTC

TCCGCATGGCCCTCGCGCCTTGAGACTGGGCAGGGCAGGCTGATGGAGGG

GCCGGGAGGGGTGGCGGTTGCCCAGGCTAACGTGTCCGTCGGTGGGGGTC

CCCTTGTCTTCGCAGAGGTGTAAGGACAAGTTGAACGCTTTGGCCATCTC

GGTGATGAACCAGTGGCCAGGAGTGAAACTGCGGGTGACCGAGGGCTGGG

ACGAAGATGGCCACCACTCAGAGGAGTCTCTGCACTACGAGGGCCGCGCA

GTGGACATCACCACGTCTGACCGCGACCGCAGCAAGTACGGCATGCTGGC

CCGCCTGGCGGTGGAGGCCGGCTTCGACTGGGTGTACTACGAGTCCAAGG

CACATATCCACTGCTCGGTGAAAGCAGGTAAGCTGGCCCTGGCCCCCCGG

ATCCGACCCAAGGAAGGCCATTGGCGCACCTCGGCTTGATTCAAGAGAAA

AAGAAACCTGGGGGGAGGCTGAGGGCCAGGAGCAGGGTCGCTGGGCGATG

ACTGCGTTTCCGCGGTGGAACCTGCCCTGTGAGGTGCCGGCCCCTCGAAA

TCACCCCTACCTTTGAGGCCACAGAGCCCAAGGTTCTCCATGCCCCGAGA

TGGGGTCCTGTGGCTTCCTGCCCGCTTCTGGAGCCCCCACTGCAGGGGGT

GGGAAAGCGTGACTGGGGGAGGGGCGCTAGGCCCTTCCAGGCGAGGGAAG

ACAGCCCTGCGCGGTTAGCCAGGTCTGGGCGAGCTCCTTCCTCTCGTTTA

GGGCTTAAGAACCAACCGCCCCCACCCGCTATCCCAAGCGCAGGGGTGTC

TATCCTGCCCCGGAGCCCGCGTCCTGGCTCCTCCCCGCCGGGCGCCCGTG

GATCCTAAGCTGCCTTTGGGGAGAGGCCTGGTGGGCGGCAGTAAACCCAG

GGGCAACCACCTCCAGCATCTGGAGGCGGCGCGCCCGGAGCCTGCGTTCC

TACTGGGAGCCGGGCCGGGACGCCCTGGGCGGCGGGCAGGCCCCGAAACG

CCGGCCCGAGTCGGCGCGAGGCTGTCTTCTCTGGGCCTGCAACGCCACAC

GCTGTTGCCGGCGAGGAACAGCCGTGGAGGAGGCGCCATCGCGCGCACGC

AAACCTCCGGCCCGAGGCTGTGTGCACAGCGCTCTTCTCCGCCCGCATAA

ATTGGCACGTTTAGCAAAGCCGTTCACGGTGAATTTCGGGGAAACTCTGC

CTTCCTCAACCCCCTTCCAGGCTTCCCTACTTGTCTCCTAAATTCCATGT

TAATGGCACTATGTTAGTAGGAAAACACTGTTAAGGTGTCAAGGCACACT

TGTAGGTAAAGGCTAGAGTGGCTTCTCGTCCCCACAGAAAGCAAAGGCGT

GGAGCGGGGGCGGCAGGGGCGGGTGTGCGGCCCGGAGAGCTCCCGGCTGC

AGGCAGGCAGGAGGCGGCGCCCCCACCTCGCGGGCTCGGCGGCGGCCCCT

GGGCCCAGGGCGCCCCCTGCGCAAAACCTCCTCCCCGGCTCCCTGCCCGC

GGGGTCCCCCTAGCGGGGGTCTCCGGAGGCCTCCTCCCAAGTGAGCAGCG

CTAATCCATCCCCCGGATCGCGCCGGGAGAGCGGAGCCGCGGCGCGGGAG

CCGCTCATTGGCATTCTGAGCACACGGGCGGGGGCGCGGGGCGCAGCGTG

TCAAGCCGGGCCGTGCGACTCGACGACTCGGGCTCGCCAGCGCCCGGGGT

CGCATTCCGGGGGGCTACGGAGGGCCTCCAACGGCCAGCCCCGCACTTCA

TGCCAGAGAAACCGATGAGAAGATTAAAAGCCCCCTGTAATTCCAGCAGG

AAGATTCTTTCTGGCAATCTCTATTTGCAAAAAGCATGATCCCGGAGATT

GGAATGCAAAGAAGACGGCCCTCCCCGCCCTCCTCCCCGGCCCCCTGCGC

TCCGCCCCAACTTCAATTATTGTCCTGGGGACAGTGAGCCTCAGAGAGCG

ACAGAGGGCTCGAGAAAGCGGGTAGTCAAGGGGCCTTGAGACCCGGCGCT

TCCAGCGCTCCGAACAGGCCCCGCCATTTAAAATTCAAATACACATCTTG

AGTGCTTGGAAGAGAGGCCTGGCTGTGCAAATAGTGCTTGTGAATTGCAC

ACGGGGTGGGGGGGGGTTGCACCTGAGCAAATAGGGAGGGGGAGGCCCGC

GAGCTGGGGAGAGAGTGAGCTGAGAACAGGGAGGGGAGAAAATGGAAGTG

TCCCCTTCCAAGAGTGTCTCCTGTTTATCCCAGAAATCACAATGACAATG

CTGGGCCCTTTATTGGATTTTAATTAGAAAATCCACACAAGCCTCGGATT

TTCACACCTCGGCCAATCTCTGGAATGTTTGTCCAGTTGCTACAACTACT

GCAGCTATTTTTCACTCCCCGCCCCCGCCCCTCCGCAGGCCCACGCCGAG

GCGCGGCAGGGTGCTGCGGGCAGGCGGGCAGGCGGGCAGGCGGGCCAGGG

GTTTCCGCCGCGCAGCCCGGGTGCTGAGTGCGCGAGCAGGCGCCGCGCCC

CGCGCCGGGGCGGGAGGGAAGGAGGGTGCGCCCGGCGCCCGCGGGAGCTC

AAGGAGGCTTCCTGAGGAATCCAAGTGCAGAGCAAACACCCTCTGGATGG

ATTCGCGGCGAGGCCGGGTGTGTGCGGAGCTGGGGGTGGGGTTGGAGGAA

GGCGGAAGGAAAGAGTGTCACCGGCCTCTGCAGGAAACGCCAGCCAACCT

CTGTGACCGCCAGCCCAGACTTAGAGAGTCGTTAAGGAATGTGTCGGAAT

CCTGTCCCTGGGGCAGTGGGGTTGGGGGAGGGAGGTGTGTGCGGGACCCG

CCTGGAATCAATCGCCCCGCCCCGCGCCTTGCGCACCCCTGGCCTAGGAG

CGCGGGCACCAAGCGTGCGCCCTCCTCCCCGAGACGCGCCTCCCTCTCGG

AACTCAATGCCCTGTCCTCTCTTCTTTCCCTTCTCCTCACCCGCAGAGAA

CTCGGTGGCGGCCAAATCGGGAGGCTGCTTCCCGGGCTCGGCCACGGTGC

ACCTGGAGCAGGGCGGCACCAAGCTGGTGAAGGACCTGAGCCCCGGGGAC

CGCGTGCTGGCGGCGGACGACCAGGGCCGGCTGCTCTACAGCGACTTCCT

CACTTTCCTGGACCGCGACGACGGCGCCAAGAAGGTCTTCTACGTGATCG

AGACGCGGGAGCCGCGCGAGCGCCTGCTGCTCACCGCCGCGCACCTGCTC

TTTGTGGCGCCGCACAACGACTCGGCCACCGGGGAGCCCGAGGCGTCCTC

GGGCTCGGGGCCGCCTTCCGGGGGCGCACTGGGGCCTCGGGCGCTGTTCG

CCAGCCGCGTGCGCCCGGGCCAGCGCGTGTACGTGGTGGCCGAGCGTGAC

GGGGACCGCCGGCTCCTGCCCGCCGCTGTGCACAGCGTGACCCTAAGCGA

GGAGGCCGCGGGCGCCTACGCGCCGCTCACGGCCCAGGGCACCATTCTCA

TCAACCGGGTGCTGGCCTCGTGCTACGCGGTCATCGAGGAGCACAGCTGG

GCGCACCGGGCCTTCGCGCCCTTCCGCCTGGCGCACGCGCTCCTGGCTGC

ACTGGCGCCCGCGCGCACGGACCGCGGCGGGGACAGCGGCGGCGGGGACC

GCGGGGGCGGCGGCGGCAGAGTAGCCCTAACCGCTCCAGGTGCTGCCGAC

GCTCCGGGTGCGGGGGCCACCGCGGGCATCCACTGGTACTCGCAGCTGCT

CTACCAAATAGGCACCTGGCTCCTGGACAGCGAGGCCCTGCACCCGCTGG

GCATGGCGGTCAAGTCCAGCTGA  -3′

(HINT:  This gene was named after a video game that was also popular around the time I was 10.)